Probe CUST_18623_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_18623_PI426222305 | JHI_St_60k_v1 | DMT400079638 | AAGGATGAAGCAAAAGTGGTCGACTCTGTTCTCGTCACTGAACTCTCTAAGCCTCTTACT |
All Microarray Probes Designed to Gene DMG400031014
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_18623_PI426222305 | JHI_St_60k_v1 | DMT400079638 | AAGGATGAAGCAAAAGTGGTCGACTCTGTTCTCGTCACTGAACTCTCTAAGCCTCTTACT |
Microarray Signals from CUST_18623_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 10542.2 | 1723.54 | 1.24455 | 0.11898 |
| ABA 1h | 8891.43 | 1505.89 | 1.18344 | 0.262629 |
| ACC 1h | 12404.2 | 1026.2 | 1.45233 | 0.106006 |
| BABA 1h | 8282.47 | 478.439 | 1.03944 | 0.115944 |
| Chitin 1h | 8062.82 | 1141.53 | 1.06412 | 0.203145 |
| Epi 1h | 8316.6 | 481.3 | 1.16017 | 0.066984 |
| SA 1h | 9907.88 | 597.938 | 1.16294 | 0.144881 |
| Me-JA 1h | 7186.71 | 854.769 | 1.0508 | 0.220499 |
| Control 6h | 9209.39 | 1417.19 | 1.08312 | 0.0765332 |
| ABA 6h | 2499.03 | 492.192 | 0.273608 | 0.0727488 |
| ACC 6h | 5138.31 | 903.572 | 0.526839 | 0.0304197 |
| BABA 6h | 8763.46 | 1210.33 | 0.927325 | 0.174336 |
| Chitin 6h | 8598.09 | 1474.68 | 0.945295 | 0.154016 |
| Epi 6h | 8895.66 | 1416.68 | 0.931798 | 0.224777 |
| SA 6h | 5637.13 | 682.115 | 0.678798 | 0.0391929 |
| Me-JA 6h | 3120.2 | 801.994 | 0.357149 | 0.0627676 |
Source Transcript PGSC0003DMT400079638 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G51720.1 | +1 | 2e-37 | 129 | 69/108 (64%) | 2 iron, 2 sulfur cluster binding | chr5:21009645-21010227 FORWARD LENGTH=108 |