Probe CUST_15246_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_15246_PI426222305 | JHI_St_60k_v1 | DMT400096975 | CAAACTTTGGCTGCTCAACAAACATTAGCCAAATTAGTAAGGATGAGGAGCAAAATATGA |
All Microarray Probes Designed to Gene DMG400046546
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_15246_PI426222305 | JHI_St_60k_v1 | DMT400096975 | CAAACTTTGGCTGCTCAACAAACATTAGCCAAATTAGTAAGGATGAGGAGCAAAATATGA |
Microarray Signals from CUST_15246_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 78.3527 | 7.91537 | 0.747477 | 0.0847676 |
| ABA 1h | 106.124 | 28.6966 | 1.06987 | 0.289017 |
| ACC 1h | 154.554 | 49.1798 | 1.26472 | 0.444316 |
| BABA 1h | 109.65 | 24.4321 | 1.03126 | 0.163308 |
| Chitin 1h | 72.7734 | 21.3613 | 0.719193 | 0.176654 |
| Epi 1h | 77.0638 | 18.9216 | 0.802826 | 0.219466 |
| SA 1h | 84.2916 | 16.5813 | 0.761862 | 0.102115 |
| Me-JA 1h | 44.5933 | 11.8635 | 0.486129 | 0.103927 |
| Control 6h | 84.7103 | 18.7075 | 0.769968 | 0.12837 |
| ABA 6h | 503.39 | 92.8359 | 4.38569 | 0.729064 |
| ACC 6h | 236.713 | 25.4097 | 1.96853 | 0.117272 |
| BABA 6h | 164.686 | 34.9473 | 1.35933 | 0.233024 |
| Chitin 6h | 132.168 | 8.91952 | 1.1922 | 0.110543 |
| Epi 6h | 121.17 | 14.1304 | 1.02102 | 0.0664107 |
| SA 6h | 124.141 | 14.2492 | 1.1953 | 0.285386 |
| Me-JA 6h | 115.607 | 22.4321 | 1.07602 | 0.173933 |
Source Transcript PGSC0003DMT400096975 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G56220.1 | +1 | 0.0 | 1229 | 642/960 (67%) | P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr5:22754871-22757792 FORWARD LENGTH=973 |