Probe CUST_13465_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_13465_PI426222305 | JHI_St_60k_v1 | DMT400017741 | ATGAACACCCATATCCAGATGATCGCGAACTCAATCGTCATAATTACGGTGTTTCTCGAG |
All Microarray Probes Designed to Gene DMG400006887
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_13465_PI426222305 | JHI_St_60k_v1 | DMT400017741 | ATGAACACCCATATCCAGATGATCGCGAACTCAATCGTCATAATTACGGTGTTTCTCGAG |
Microarray Signals from CUST_13465_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 342.885 | 28.065 | 2.08648 | 0.128895 |
| ABA 1h | 133.421 | 20.9964 | 0.902509 | 0.191318 |
| ACC 1h | 269.672 | 77.2183 | 1.44208 | 0.416846 |
| BABA 1h | 318.632 | 50.4978 | 1.97326 | 0.16291 |
| Chitin 1h | 392.79 | 37.4929 | 2.64931 | 0.47469 |
| Epi 1h | 197.214 | 11.9742 | 1.39229 | 0.0998023 |
| SA 1h | 332.623 | 39.68 | 1.95685 | 0.261181 |
| Me-JA 1h | 393.328 | 23.0436 | 2.94915 | 0.257954 |
| Control 6h | 47.8668 | 18.7186 | 0.243307 | 0.096049 |
| ABA 6h | 163.718 | 39.5667 | 0.874765 | 0.22319 |
| ACC 6h | 133.262 | 24.1809 | 0.69011 | 0.0466439 |
| BABA 6h | 232.093 | 86.625 | 1.11464 | 0.38194 |
| Chitin 6h | 72.1623 | 10.6863 | 0.406211 | 0.0545028 |
| Epi 6h | 61.3712 | 5.58365 | 0.333057 | 0.0302632 |
| SA 6h | 26.3318 | 4.65268 | 0.157631 | 0.0286733 |
| Me-JA 6h | 67.3108 | 15.2213 | 0.389926 | 0.0677295 |
Source Transcript PGSC0003DMT400017741 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |