Probe CUST_1216_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1216_PI426222305 | JHI_St_60k_v1 | DMT400097397 | GAGGCTGATGATTATGATCTCAAGAATTTTTGTTTTGATTCCAAGCGTAAACACTCTTGA |
All Microarray Probes Designed to Gene DMG400046968
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1216_PI426222305 | JHI_St_60k_v1 | DMT400097397 | GAGGCTGATGATTATGATCTCAAGAATTTTTGTTTTGATTCCAAGCGTAAACACTCTTGA |
Microarray Signals from CUST_1216_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 81.7087 | 15.953 | 0.8325 | 0.138243 |
| ABA 1h | 100.585 | 9.86158 | 1.19996 | 0.0910482 |
| ACC 1h | 55.7101 | 18.0979 | 0.492083 | 0.197981 |
| BABA 1h | 51.0812 | 10.9537 | 0.533559 | 0.0784344 |
| Chitin 1h | 33.0246 | 3.71504 | 0.390085 | 0.0438517 |
| Epi 1h | 44.6646 | 4.08715 | 0.548772 | 0.0506148 |
| SA 1h | 54.4846 | 6.77844 | 0.557149 | 0.0830267 |
| Me-JA 1h | 49.7706 | 4.35288 | 0.64653 | 0.0565183 |
| Control 6h | 152.066 | 44.0936 | 1.48344 | 0.356453 |
| ABA 6h | 116.388 | 7.53985 | 1.1669 | 0.0755702 |
| ACC 6h | 147.701 | 9.4556 | 1.36729 | 0.115424 |
| BABA 6h | 137.256 | 20.4043 | 1.27578 | 0.164082 |
| Chitin 6h | 130.704 | 22.7376 | 1.26575 | 0.203266 |
| Epi 6h | 121.041 | 13.182 | 1.13146 | 0.118854 |
| SA 6h | 121.604 | 30.292 | 1.21489 | 0.214154 |
| Me-JA 6h | 138.908 | 17.2542 | 1.46282 | 0.125949 |
Source Transcript PGSC0003DMT400097397 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc02g088170.1 | +1 | 0.0 | 1053 | 520/540 (96%) | evidence_code:10F0H1E1IEG genomic_reference:SL2.50ch02 gene_region:44903957-44905576 transcript_region:SL2.50ch02:44903957..44905576- go_terms:GO:0034046 functional_description:Pentatricopeptide repeat-containing protein (AHRD V1 ***- D7M7B4_ARALY); contains Interpro domain(s) IPR002885 Pentatricopeptide repeat |
| TAIR PP10 | AT5G15300.1 | +1 | 0.0 | 625 | 294/528 (56%) | Pentatricopeptide repeat (PPR) superfamily protein | chr5:4968384-4970030 REVERSE LENGTH=548 |