Probe CUST_12002_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_12002_PI426222305 | JHI_St_60k_v1 | DMT400076601 | GAGTCTCATCATCAATACTTTTTACAGTAACAAAGAGATCTTTCTCAGGGAACTCATTAG |
All Microarray Probes Designed to Gene DMG400029787
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_12002_PI426222305 | JHI_St_60k_v1 | DMT400076601 | GAGTCTCATCATCAATACTTTTTACAGTAACAAAGAGATCTTTCTCAGGGAACTCATTAG |
Microarray Signals from CUST_12002_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 2079.91 | 120.317 | 2.2177 | 0.128089 |
| ABA 1h | 1489.59 | 239.222 | 1.75586 | 0.297864 |
| ACC 1h | 1431.94 | 392.905 | 1.35344 | 0.358863 |
| BABA 1h | 1238.24 | 366.092 | 1.26035 | 0.279635 |
| Chitin 1h | 688.3 | 43.3333 | 0.814291 | 0.0471794 |
| Epi 1h | 1084.78 | 152.638 | 1.31292 | 0.209217 |
| SA 1h | 1188.79 | 254.618 | 1.17016 | 0.240328 |
| Me-JA 1h | 794.945 | 46.0416 | 1.03955 | 0.0753805 |
| Control 6h | 671.405 | 127.617 | 0.688114 | 0.0757707 |
| ABA 6h | 734.22 | 92.9004 | 0.724677 | 0.0634662 |
| ACC 6h | 1321.41 | 156.012 | 1.21148 | 0.201069 |
| BABA 6h | 1277.71 | 77.8485 | 1.2146 | 0.0702252 |
| Chitin 6h | 763.587 | 44.3721 | 0.764258 | 0.0443057 |
| Epi 6h | 798.19 | 84.89 | 0.746721 | 0.0432821 |
| SA 6h | 732.242 | 135.491 | 0.765157 | 0.15452 |
| Me-JA 6h | 894.823 | 70.8609 | 0.95377 | 0.14822 |
Source Transcript PGSC0003DMT400076601 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G56010.1 | +1 | 0.0 | 1087 | 649/700 (93%) | heat shock protein 81-3 | chr5:22681410-22683911 FORWARD LENGTH=699 |