Probe CUST_1174_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1174_PI426222305 | JHI_St_60k_v1 | DMT400003608 | CAGATATCTTCATTTCCTAAACTATACCCTCGTTACTCAAGCAAACAGAGAGAAACTTTT |
All Microarray Probes Designed to Gene DMG400001426
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1174_PI426222305 | JHI_St_60k_v1 | DMT400003608 | CAGATATCTTCATTTCCTAAACTATACCCTCGTTACTCAAGCAAACAGAGAGAAACTTTT |
Microarray Signals from CUST_1174_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.59543 | 3.19541 | 0.679812 | 0.387229 |
| ABA 1h | 12.2701 | 3.58443 | 1.49311 | 0.63439 |
| ACC 1h | 7.26312 | 3.75692 | 0.84755 | 0.442723 |
| BABA 1h | 11.8277 | 3.46822 | 1.35516 | 0.503016 |
| Chitin 1h | 10.1461 | 3.23006 | 1.29137 | 0.471912 |
| Epi 1h | 7.41105 | 3.13103 | 0.971253 | 0.465077 |
| SA 1h | 6.56549 | 3.18257 | 0.771918 | 0.380707 |
| Me-JA 1h | 8.71083 | 3.26971 | 1.22321 | 0.515652 |
| Control 6h | 24.3819 | 6.8164 | 2.65298 | 0.726455 |
| ABA 6h | 5.85288 | 3.37876 | 0.668386 | 0.38557 |
| ACC 6h | 6.54963 | 3.88906 | 0.677745 | 0.392476 |
| BABA 6h | 16.6191 | 3.74197 | 1.73866 | 0.429572 |
| Chitin 6h | 11.0078 | 3.64729 | 1.24801 | 0.417697 |
| Epi 6h | 23.557 | 14.8729 | 1.64098 | 1.45063 |
| SA 6h | 7.44621 | 3.46485 | 0.901011 | 0.432594 |
| Me-JA 6h | 18.9128 | 6.75877 | 1.86832 | 0.958032 |
Source Transcript PGSC0003DMT400003608 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc02g088100.2 | +2 | 4e-156 | 445 | 222/226 (98%) | genomic_reference:SL2.50ch02 gene_region:44867449-44868915 transcript_region:SL2.50ch02:44867449..44868915- go_terms:GO:0005199 functional_description:Expansin (AHRD V1 ***- Q9ZP31_SOLLC); contains Interpro domain(s) IPR007112 Expansin 45, endoglucanase-like IPR007117 Pollen allergen/expansin, C-terminal |
| TAIR PP10 | AT1G26770.2 | +2 | 1e-125 | 368 | 185/226 (82%) | expansin A10 | chr1:9259775-9260792 FORWARD LENGTH=259 |