Microarray Probes on PGSC0003DMT400096763

Probe IDChipProbe Sequence
CUST_6626_PI426222305 JHI_St_60k_v1 ATGACAAACTCACTCGTCCGGATTGGAACTGTAGAAGGTGATCTGGTAAAAAGAGCGCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400096763

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400096763 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G11090.1 +1 9e-42 143 103/222 (46%) serine-rich protein-related | chr5:3524796-3525449 FORWARD LENGTH=217

Transcript Sequence (606 bp)

>PGSC0003DMT400096763 606 pgsc_dm_v3.4
ATGGAGGCTTCATCTTCTAGAAGCAAAACTCATGGTTCAAGTTTTCATCACCATTTTCAA
CGATCCACTTCACCTTCGGGTCGGTTCTGCTCATACTCAATGTCTTCAACTTCACCTAGT
TTTTCCAGTTTCTCCAACAGGGATTCCGATTCCGATTTCATGACCCGATCCACATCTCCA
ACCCGGGTGAATCTTCGCCGATCCGTTTCCCCATCGCCAAATGTAAGGTTTTCCGCCTCT
GCAGGCCGTTCGATTTCAGTTTACCCTCATCAACAAAAGCAGACCAGCAGGCCGTTGCCG
TCTAATCAGAAGAAAACATGCATGTGCTCACCGACAACGCATCCAGGTTCATTCCGTTGC
AGTTTTCACAAAAATATGAGCCAAAATCGGAGTCATTCAAATTCCTCTTATCGATCTAGC
TATCACCTGAACATGCGGAGATCGGCGATGACAAACTCACTCGTCCGGATTGGAACTGTA
GAAGGTGATCTGGTAAAAAGAGCGCTTGCCGCTTTGATCCGTCCATCTTCTCATCAGCTC
AGGCGAAGAGACGACTTTCAGCCGCGACCTAGCCGGCTCTCCGTCATGTCGAAGGCCGAG
AATTAA