Microarray Probes on PGSC0003DMT400092427

Probe IDChipProbe Sequence
CUST_32260_PI426222305 JHI_St_60k_v1 TGAATATTGAAGGTCATTTGCCACACCTTAGCGCCCCGAATTTATTGGCTCAAGAGCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400092427

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400092427 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G03990.1 +1 9e-58 182 93/118 (79%) alpha/beta-Hydrolases superfamily protein | chr3:1033788-1034591 FORWARD LENGTH=267

Transcript Sequence (366 bp)

>PGSC0003DMT400092427 366 pgsc_dm_v3.4
ATGGAGGCAAATTATGAAGCATGGGTCAATGGTTTTGCCCCGTTAGCCGTCGGAGCCGAC
GTTCCGACGGCTGTACGAGAATTCAGTAGGACATTGTTCAATATGAGACCGGACATAACA
TTGTTTGTGTCAAGGACAGTGTTTAATAGTGACATGAGGGGAGTTTTAGGTCTTGTGAAA
GTACCATGTCACATTTTTCAGACAGCAAGGGACCACTCTGTACCTGCTTCAGTCGCGACG
TATTTAAAGAACAACCTTGGTGGGAAGAACACCGTGCATTGGTTGAATATTGAAGGTCAT
TTGCCACACCTTAGCGCCCCGAATTTATTGGCTCAAGAGCTAAGGAGAGCTCTTTCTCAT
AGGTGA