Microarray Probes on PGSC0003DMT400087395

Probe IDChipProbe Sequence
CUST_13028_PI426222305 JHI_St_60k_v1 TTTGTGTTTGATGGGAGGAACGTTGTTGACGCATCAAAGCTCAGAGAAATCGGGTTTATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400087395

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400087395 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G29360.1 +1 0.0 866 425/480 (89%) UDP-glucose 6-dehydrogenase family protein | chr3:11267375-11268817 REVERSE LENGTH=480

Transcript Sequence (1443 bp)

>PGSC0003DMT400087395 1443 pgsc_dm_v3.4
ATGGTGAAGATCTGTTGCATTGGAGCTGGATATGTTGGTGGACCAACTATGGCAGTCATT
GCCCTCAAATGCCCCTCAATTGAAGTGGCTGTTGTTGATATCTCTGTTGCCCGAATCACA
GCTTGGAATAGCGATGAGTTGCCTATCTATGAGCCTGGACTTGATGATGTGGTGAAGCAA
TGCAGAGGAAAGAACCTTTTCTTCTGCACTGAAGTAGAGAAACATGTCTCTGAAGCAGAC
ATCATCTTTGTGTCGGTTAACACCCCAACAAAGACTCGAGGACTTGGAGCTGGAAAAGCT
GCAGACCTTACATACTGGGAGAGTGCTGCTCGAATGATAGCTGATGTATCCAAGAGTGAT
AAGATTGTTGTGGAGAAATCAACTGTTCCGGTTAAAACAGCTGAGGCAATCGAGAAGATC
CTCACTCATAACAGTAAGGGAATTAACTATCAGATCCTTTCGAATCCAGAATTTCTTGCT
GAGGGAACTGCAATTCAGGATCTTTTTCATCCAGACCGCGTTCTAATTGGAGGAAGAGAC
ACCCCTGAAGGGCAAAAGGCAATCCAGACCCTAAAAAAAGTTTATGCGCATTGGGTGCCT
GAAGACAGAATCATCTGCACCAATCTCTGGTCAGCAGAGCTCTCGAAGCTCGCTGCCAAT
GCCTTCTTGGCTCAGAGGATTTCATCAGTTAACGCTATGTCAGCCCTTTGTGAAGCTACT
GGGGCTGATGTTACACAGGTGTCCAATGCTGTTGGTAAGGACAGCCGAATTGGACCCAAA
TTCCTCAATGCCAGTGTTGGTTTTGGTGGTTCTTGTTTCCAGAAGGATATCCTCAACTTG
GTTTACATATGTGAATGCAATGGCCTCCCAGAAGTTGCCAGTTACTGGAAGCAGGTGATC
AAGGTGAATGACTATCAAAAGAGTCGTTTTGTTAACCGTATGGTCTCCTCCATGTTTAAC
ACAGTTTCTGGTAAGAAAATTGCCATTCTTGGATTTGCCTTCAAAAAAGACACAGGTGAC
ACTAGGGAAACTCCTGCAATTGATGTCTGCAAAGGCTTGTTGGGAGACAATGCTCACTTG
AGCATATATGATCCACAGGTCACTCAGGAACAAATACAAAGGGATCTTTCCATGGAAAAG
TTCGACTGGGACCATCCAACTCACCTCCAGCCAATGAGTCCTTATGGAGTGAAGCAAGTT
AACGTGGTGTCGGATGCTCACGAGGCAACAAAAGACGCCCACGGTCTCTGCATTCTCACT
GAGTGGGATGAGTTCAAAACACTTGATTTCAAGAGGATTTATGATAACATGCAAAAACCT
GCATTTGTGTTTGATGGGAGGAACGTTGTTGACGCATCAAAGCTCAGAGAAATCGGGTTT
ATCGTTTACTCCATTGGTAAACCTTTGGATGCATGGCTCAAGGATATGCCAGCAGTGGCA
TAA