Microarray Probes on PGSC0003DMT400086558

Probe IDChipProbe Sequence
CUST_24003_PI426222305 JHI_St_60k_v1 GTTGTTAACAATCAGATAAAAGCTGTAGACATGCTTTGCCAAGGTGACGAGATGGACATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400086558

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400086558 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26040.1 +1 1e-65 219 141/430 (33%) HXXXD-type acyl-transferase family protein | chr3:9519741-9521069 FORWARD LENGTH=442

Transcript Sequence (1266 bp)

>PGSC0003DMT400086558 1266 pgsc_dm_v3.4
ATGTTGAAGCCCTCAATTCCTACCCCGAATCACCTTCAGACCCTCAAGCTTTCATTTTTC
GATCAGATGGTTCCTCGTGCATATGTACCAGTACTCTTCCACTACTTGCCAAGCTGCAGT
ACGACTACTGAAAGATGTGATAAGTTGCAAAAATCTTTGGCCCAGATATTAACCAACTTT
TACCCTATAGCAGGGAGATTTAATGAAGATGAATTCTCAATTCAGTGCAATGATGAAGGT
GTTGAGTATGTCCAAACCAAAGTCAGCGCGGATCTTGCTGAATTTCTTCACCAAGGACCC
AACACTGAGCTTTTGAATGATTTTCTTCCATGGCCTAGTGCTGTTCCACCATACTCAGAT
CTACCATCAAGTCCATTACTTGGTGTCCAAGTGAACCTATTCAATTGTGGAGGACTAGTC
ATGGGCATACAAATTTCACACATCGTAGCTGATGCTTTCACTTTAGCAACATTTGTCAAG
GAATGGGCGCACACTTGCCTTACAGGAACGACAAAAGATTGTCTCCCAAGTTTTGGTCAC
TTGTCATCGCTATTTCCCACAAGAGTGCTATCAGGAATTCAATATTCACCACCATCCAAC
AGGGGCACTAAGAGTTTCACGAGGAGGTTTGTGTTTGATGCTTTGGCGATAACTAAGCTC
AAAAATACAATCAAATATTCAAGTGCCATTAAGCCTACTAGAGTGATGGTCGTTATGTCG
TTAATATGGAAGGTTCTTGCAGGCATTTCCACCGCCAAAAATGGACATTCAAGGGGATCA
TCTTTTTTATTTCCTATTAATTTGAGAGGAAAATCAAAGTTACCATCTTTAGAACATGCT
CTAGGTAATGGTACCATGTTTGGAATTGCTGATCTAGAGGCAAGCCAGGAGTTGAATCAT
GAGTTGGTAGGAAATACAATACGGGACACATGCGTAAGCATTGGTAAGGCGGCAAGAGTT
GATGATGTTTTCTGTTTAGTTGTTAACAATCAGATAAAAGCTGTAGACATGCTTTGCCAA
GGTGACGAGATGGACATTTATTCGTGCACTAGTTGGTGTGGATTCTCTTGGTATGAAGCT
GACTTTGGTTGGGGAAAGCCATTCTGGGTGAGCTCCGTTAGCCTTGATGCTATTGAAGTC
ATTATGCTGATGGACACAAAGGATAGTGATGGAGTAGAAGCATGGGTTAGTTTGAAGGAG
AATGACATGGCTGAATTCGAGAGAGATGATGATATCTTGACATTTTGTTCTCCACTTCCA
AAGTAG