Microarray Probes on PGSC0003DMT400084506

Probe IDChipProbe Sequence
CUST_41038_PI426222305 JHI_St_60k_v1 CCGAGCCCGAAGGCCCGGAATTTGATTATTGGTGAGCTGTTTAGGACTGTTTTTATTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400084506

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400084506 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G23340.1 +1 3e-46 155 85/145 (59%) DREB and EAR motif protein 3 | chr2:9938186-9938716 FORWARD LENGTH=176

Transcript Sequence (805 bp)

>PGSC0003DMT400084506 805 pgsc_dm_v3.4
GGCAATTTCCCTTAAAAATAAAATCAACGTGGAAAACCATAGTACCCAAATTGTGGCCAA
CGCCCATTTCTCTTTCATGGGCATTCCTCTAGATTACAGGGAAATTTTTTGTTCCAATTA
ACCCCAAAAATTGATAAGGAAAGAGGAAAAATGGAGGTTGACGGCGTCAGAAGCGGCGAT
GCTGGGGTGGTTGGAGGCGGAGGAGGAGGAGGAGGAGGGTGTTGCTCCGGGAAGAGAAAA
AACGAGAGGGCTTACAAAGGAATAAGGATGAGAAAATGGGGGAAATGGGTTGCTGAAATC
CGAGAGCCAAATAAACGGTCGAGGATATGGTTGGGCTCGTATACGACGCCTGTTGCAGCT
GCAAGAGCATACGATACAGCTGTTTACTATCTCCGGGGGCCATCGGCCCGGTTAAATTTC
CCGGAGCTGTTAGTCGGTGATAGCGGCGAACTCAGTGATTTGTCTGCTGATGCAATTCGT
AAGAAGGCTGTTGAAGTAGGTGCTAGAGTTGACGCTATCCAGAGTTCAATGGCTATTTCC
GATGATGACGGCGACGGCGATAATCAGCTACGGCGACATGAAAGCCCGGCCCGATTAAAG
CCTTGTTGGTTTCAGGAAAAGCCTGATTTAAACTTGAAGCCCGAGCCCGAAGGCCCGGAA
TTTGATTATTGGTGAGCTGTTTAGGACTGTTTTTATTTTTCTGAATTATTATCTTTTTTC
TTTTTTTTAATTTAAATTTTGAGCTTAATATAATCTGAGTACAACTGTACTTATGTTGTA
ACATGTAAATATAGTCTTTGTCAAA