Microarray Probes on PGSC0003DMT400083793

Probe IDChipProbe Sequence
CUST_24084_PI426222305 JHI_St_60k_v1 CTATCAATACAGTATGTGTAATATAGCTCTGATCGATGTTACTTTGGTTTAATTCGGGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083793

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083793 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G09530.1 +2 1e-11 66 62/145 (43%) hydroxyproline-rich glycoprotein family protein | chr5:2960080-2961192 REVERSE LENGTH=370

Transcript Sequence (1608 bp)

>PGSC0003DMT400083793 1608 pgsc_dm_v3.4
CTTGAAGCCAATGACACATCCACTCTTATAAACATTATTCTTTCTTATAGCTTCTACCAT
CTGCAGAAAAATGGCTCAACATTACCACATATCATCTCTCTTACTGCTTACATTTCTCAA
TATATTCTTCATTCATGGCAACATAAGTGGCGCGACTGCACGCCACCTCCTTGAGACACC
CGTTCCTGAGATACCTAAACCAGAACTCCCAAAAGTTCCAGCCTTGCCAAAGCTTGAAAT
CCCAACTGTGCCGAAGCCTCAGCTTCCAACCATACCAAAGCCTCAGCTACCAACTCTACC
GAAGCCCCAGTTACCAACTTTGCCAAAGCCTAAGATGCCTGAGATCCCTACTATGCCAAA
ACCTGAGCTTCCTACTATGCCAAAGCCCGAGATTCCTTCAATGCCAAAGCTAGAGTTTCC
TCCCTTGAAAAAGCCAGAAATCCCACCAGTGCCTAAGACTGAGGTTCCTCCGGCTATGAA
AAAGCCTGAAGTTCCAACTCTACCAAAGCCTGAGCTACCGAGTCTGCCAAAGCCAGAAAT
TCCACAACTACCAAAGCCAAAAGTCCCAGAACTTTCAAAGCCAGAAGTCCCAACTATGCC
AAAACCGGAAATCCCAGAACTACCAAAGCCAAAAGTCCCTGAGCATCCAAAGTTAAATAT
CCCAACAACGCCAAAGCCTGAAATCCCAGAACCAAAAGTCCCAGAGCTTCCAAAGCCTGA
AATACCAACTACGCCAAAGCCTGAAATACCAGAATTACCAAAGACAAAAGTTCCAGAACT
TCCAAAGCCAGAAATCCCAGAATTACCAAAGCCAAAAGCCCCAGAGCTTCCAAAGCTAAA
AGTCCCAACAATGCCAAAGCCTGAAATCCCAGAACTTCCAAAGCCAAAAGTTCCAGAGCT
TCTAAAACCTGAAGTACCAACTATGCCAAAGCCTGAAATTCCGGAACTACCAAAGCCAAG
AGTCCCAGAACTTCCAAAGCCTGAAGTACCAACTACGCCAAAGCCTGAAACCCCTGAACT
ACCACAGCCAAAAGCCCCAGAGCTTCCAAAGCTAAAAATTCCAACAATGCCAAAGCCTGA
AATCCCAGAACTGCCAAAGCCTAAAGTCCCAGAGCTTCCAAAGCCTGAAATCCCAAAACT
TCCTAAGCCAGAAGTACCAACTATGCCCAAACTTGAAATCCCAGAACTACCAAAGCCAAA
AATCCCAGAGCTTCCAAAACTAAAAGTCCCAACTATGCCAAAGCCTGAAATTCCAGAACT
TCCTAAACCAACTCTTCCTTCACTTTCTCCACCATACAAACCCGCTACTCCTTGAGTAAA
TTATATGCTACTTTCACTCTATTAGGAAGTACCCAACTAATATTTTGCGATTTCCATCTT
AGTCTATGAAGCTTGCGACCTGAGCTGTGACATGGAGATAGTATTGGATACTTTCTGCTA
GGAGTAGAAATTGTAATTCTTTTTTAGTAGTATTTGAATTGAATGTACCATGTTTGATGT
GTCGTTATATTACGAGTATTTTATTACTTTCTATCAATACAGTATGTGTAATATAGCTCT
GATCGATGTTACTTTGGTTTAATTCGGGCTAATATTTCAAAAGGTCAG