Microarray Probes on PGSC0003DMT400079994

Probe IDChipProbe Sequence
CUST_36540_PI426222305 JHI_St_60k_v1 AGGTAGCCTTTAGAATGATGAGTAATATGTATGATCACGCTCAACGGTCTTGTGATGCCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079994

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079994 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G09670.1 +1 5e-159 459 230/359 (64%) Oxidoreductase family protein | chr4:6107382-6109049 REVERSE LENGTH=362

Transcript Sequence (1478 bp)

>PGSC0003DMT400079994 1478 pgsc_dm_v3.4
CCATTTTCCACTACCTCATCAGTTAGCTTTGTGCTTTGAAAGTTCCATTTTCAAGTTTTC
AATCTGAGAAAAACAATAATGGCAGAGTCGACGCCGGTACGTTTTGGCATATTAGGTTGC
GCTAACATAGCTCGTAAAGTATCACGCGCCATCGCACTTGCTCCAAACGCCACTATCTCC
GCCGTCGGCAGCCGTTCGATCGAAAAAGCGACGGCGTACGCCAAGGAAAACGGGTATGCG
TCAACGACGAAGATTTACGGCAGTTATGAGGCGGTTCTGGATGATCCGGAAGTGGATGCA
GTTTACGTTCCTCTTCCGACGAGCCTGCATGTGAAGTGGGCCGTGTTGGCGGCCCAGAAG
AAGAAGCATGTTTTGCTGGAAAAGCCTGTTGCGTTAAACGTGAAGGAGCTGGATGTGATA
CTGGAGGAGTGTGAATCGAATGGGGTGCAGTACATGGATGCTACTATGTGGATGCATCAT
CCGCGTACTGCTAAGATGAAAGAGTTCCTCTCTGATTCTCAGCGTTTTGGACAACTCAAA
TCGGTACATAGCACATTTGCTTATCTTGGTGACACTGAGTTTCTTGAGAATAACATTCGT
GTGAAGTCCGATCTTGATGCTCTTGGTGCTCTAGGTGATGCTGGTTGGTACAGTATTCGG
GCAATCTTGTGGACTAGTGATTATGAATTGCCAAAAACAGTGACAGCTCTGCGTGATCCA
GAATTTAATGAAGCTGGAGTTATCCTATCTTGTGGCGCTTCTTTGAGTTGGAAAGACGGA
AGGGTAGCAACTTTTTATTGTTCGTTTTTAGCCAATATTGCCATGGATATCGTTGCTAGT
GGATCCAAAGGAAATTTGCGGGTCCATGACTTTGTAGTTCCATTTCAAGAAAATGTTGCT
CCATTTTACACTGTGGAAGGTTCGTGGATTGGTGAACTTGCTACATCGATTCATCCTGCA
CCAAGTGAGCATCAAGTCAATACAGATCTTCCTCAAGAGGCTTTGATGGTAAAGGAGTTT
TCAAACCTGGTTGGAAGTATCAAAGGGGAAGGTTCTAAACCTGAGAAGAAGTGGCCAACG
ATTAGTAGAAAGACACAACTTGTGGTGGATGCTGTCAAGGCATCAATTGAGAAAGGTTTC
GAGCCCGTTGAGATCATCTATTAACTAATTGGTGTTTAGCTATCTTCCTTGTGAACCCTG
AACGCTATCTGTTGTTGTAACTGAATGTTGTATTTCTGAATAAGGCTTGTAAGTCTCAGT
TTGTTCAGAGTGTGTATGTAATATGGTTGTTTGAAAATGAATTGGCCGAGCTAGTTTGAA
CAACTTGTATTTTCATGAAAAATAGCAGCCTCCCTTCCTCCCGGATCTCCACGGAACCGA
ACAGATTAAGGAACCGGGGAGGGAAGATCCAATCTCTCAGGTAGCCTTTAGAATGATGAG
TAATATGTATGATCACGCTCAACGGTCTTGTGATGCCC