Microarray Probes on PGSC0003DMT400079099

Probe IDChipProbe Sequence
CUST_32431_PI426222305 JHI_St_60k_v1 GAAGAAAATCTTTTTGGTAGCGCCACCTCAAATAGGCCTGATGTGAGCTCTGAACAGGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079099

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079099 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G15700.1 +2 7e-40 138 66/103 (64%) Thioredoxin superfamily protein | chr4:8937545-8937853 FORWARD LENGTH=102

Transcript Sequence (966 bp)

>PGSC0003DMT400079099 966 pgsc_dm_v3.4
CTCTCAACAAAAATCACCAGACCTCAAAATAACTCCTCTCTCTGATCTCTTTATATTTAT
TTTGTTGAAATTTGTAATGGAGAGAGTAAACAAAATGGTAACTGAAAAGCCAGTTGTCAT
ATTCAGCAAGACTGGTTGCTGCATGAGCTACTCCATTAAGTCTTTCTTCTCTGATCTCGG
CGTTAACACCGCCGTTTACGAGCTCGATGAGATGCAAAGAGCTGGCCGTGAGATTGAGGC
CGTGCTTTCGAATCTCGGCTGCAATCCCACGGTGCCGGCGGTGTTCATCGGCGGCCAAAT
GGTCGGTGGAGAAAGTGAAGTCATGAGTCTTCATTTACAAGGGGCCTTGAAGCCTAAACT
CAAAACAGCTGGTGCTTTATGGGTTTAATTATAAATTACCTAAAATAAAAATAATCAAAA
TGATCGTGGTCATTTTTATTTTTTTTAGAATAATACTTCTAGCTATCGTTTCTAGATCAA
TAAAGATTGTGATAGAATAGTGATATTCCTTCATCATCATCCTTATTAATCACTTTATCT
TCAACGTGAGACTTTTGAGTAGGAAACAAAAAAAAAAGATATATACCAGAGCGTTGCTAC
TTTTTATAGCAAGAAAAAGGAAAAAAGAAGTAAAAATGTGCCTATAAGAATTTTACTCAC
ATGTCTTGCTGACAAAGTGCATAACTACTGACAATATGGATCGTAATGTATAAGTGAGAC
TGCTCTACCTTTAACCAAAGGTTTTGGATTCGAACCTTGAATATGAAGAAAATCTTTTTG
GTAGCGCCACCTCAAATAGGCCTGATGTGAGCTCTGAACAGGAAAAAAAGAAGAAGCAAA
GTGCATAACAATGTAAAAAGTTGTTGTACCCATTTGTGTATTATTTGTAATTTCCGTTAA
GAATTTACTTGCTGTAATTTATGTTAGCAATCTGTGTTAAAAATCAATATTGTTGATTCA
ACAAAC