Microarray Probes on PGSC0003DMT400078815

Probe IDChipProbe Sequence
CUST_33623_PI426222305 JHI_St_60k_v1 TATCGACCGTTCATCTTGGTTGATGTGTTTTAGCAATCAGCTAACTAAGATTTAATACGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078815

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078815 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01300.1 +3 1e-31 114 52/116 (45%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15010.1); Has 73 Blast hits to 73 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:151221-151691 REVERSE LENGTH=156

Transcript Sequence (563 bp)

>PGSC0003DMT400078815 563 pgsc_dm_v3.4
CAGCCATGGAAAAAGTACTCTTAATTCCATCTAATTTTTCTTTCTCCAATCCCAAGAAAT
TTCTTATTCCCCGGAGAAGATCAAAGGGTAAAATTTCTTCTCATCGTAATGATTCTTGTG
ATTGGGATTATAGAGGGAGATTAGTGGATAAAAGTATGATTATATTAAGGAAGAGAGTTC
ATGAAATGAAGGTAATTGAAAGAAATTATGAGCCACCAGTAGAATGGATGGAATGGGAGA
AACAGTATTACGCTAATTATGATGAGTTAATTTGTAATTTAGTAGGGTATTTACAAATAC
AATTGTTAAGTACAAGGCCTAGTTTGGCTCTAGGTATGTTAATCCTCTTCATCATTAGTG
TGCCAGCTTCAACGGCCATGATTTTCATCAATTTGACAAGTGGCATCTTATCGACCGTTC
ATCTTGGTTGATGTGTTTTAGCAATCAGCTAACTAAGATTTAATACGTATTTTATGGACA
TATTGTAGATTGGTAATTGTATTTTGTATTTGCAAAATGAATCCCATATATACAAATGTA
ACACCGAGTAACTAAAATTTGTC