Microarray Probes on PGSC0003DMT400075700

Probe IDChipProbe Sequence
CUST_29468_PI426222305 JHI_St_60k_v1 CCATTCGTCTCAATTTGTATGATACCTTTTGTTTCAAAATGTTTGACAATATTGGGTCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400075700

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400075700 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G11330.2 +1 0.0 417 225/534 (42%) S-locus lectin protein kinase family protein | chr1:3810372-3813416 FORWARD LENGTH=842

Transcript Sequence (2740 bp)

>PGSC0003DMT400075700 2740 pgsc_dm_v3.4
AAAAAGATGAGCAACAGCAGCAGCAGAAGAAGAAATTTGCAATATTTTGTTCATATAATT
CTTGTTATTCTTCGTTTTATCGATACAGGATTATGCAGTGAAGTGGATAACATTACCAGC
ATTCAATCTCTGAGAGATCCTGGAATTTTATCGTCTCCAGGAGGCGTATTCAAGTTAGGA
TTTTTCAGTCCTCAAAACAGTACTAATAGGTATGTTGGTATTTGGTACAATTTTTCTGTA
ACAACTGTCATTTGGGTGGCTAATAGGGACAAACCTTTAAGAGATTCTTCTGGTGTTGTA
AAGATATCTCGTGATGGAAATGTCGTTATAACGAATGGAGAGGAGGAGATTCTTTGGTCA
TCAAATGTTTCAACTTCTCAGGTAAACTCAATTGGCCTTCTCCAAGATTCTGGGAACTTT
GTTCTCGTTGATCATCGGGACAATATGAGCACTATATGGCAGAGTTTTGAACATCCTTCT
GATTCAACTATTCCTAGAATGAGAATAAGTGAAAATACAAGGACAGGGGAGATGGTAGAA
GCAAGATCTTGGAGAAGTCCTTCGGATCCTAATATCGGAGACTTTTCTTTAAGAATGAAC
TCTGGAGTCATTCCTCAAGTGTATATATGGAAAGGAAACCGTCCCTATTGGCGAACTGGT
CAATGGAATGGACAGATCTTTATAGGAGTGCAGAATATGTATGCTGTGGTATCTGATGGA
TTTAATGTAGTGAATGATCGCGAAGGTACTGTATATTTTACTGGACCTATTCGTGATAAT
TTTTTAAGGATATTAGTCTTGGATTGGAGAGGGAACTTGGTTCAATCATATTGGAATGTG
ACTGAGACAAACTGGAAGATAATATGGTCAGCTCCCAGTAACAATTGTGAAGTTTATGGA
ACGTGTGGTCCATTTGGGAGCTGCAATCATTTGGAGTCGCCGGTCTGTTCTTGTCTGAAA
GGTTTCGAGCCAAAGCATAGGGAAGAATGGGAAAAGGGGAATTGGACTAGTGGTTGTGTT
AGGAGGAGTGCTTTGCAATGTGAAGTTAAGAATAACACCGCGAATTCAAGTAAAGAAGAC
GGATTTCTAAAGATGGAGTTGATGAAATTGCCTGATTTTGCTGAAAGGTCATCTACTTCA
GAAGACTTATGTAGAAGCCAATGCTTGGGGAATTGTTCCTGCATAGGGTATGCATTTGAT
TCAGGTATCGGCTGTATGTCGTGGAGTGAAATGATTGACATTCAGCAGTTCCAAAGCTCG
GGGAAAGATCTCTATATTCACGTGGCAAATTCAGAGCTTGTGTTTTCTGCAGATCATGGT
AAAGACATAAAGAAAATCGTAATTCCAGTAATTGTTGGTTCTCTTACACTCTGTGTTTGT
CTGTTCCTTTGCTATACAATGGTGATCAGACGTAGAGGAGTGAAAAGAGAGGAGGTAGCT
TTACTTGGTAACAAAAGTCCAGTTAATATGGAAGAATTACCAGTCTTCAGCCTCGATACG
ATTGCAAATGCAACATCCCAATTCAATGAGGATAATAAGCTTGGTCAGGGCGGTTTTGGT
CCAGTTTACAAGGTACGAGTTTCATCTCTCTCGATCACTTCCCATAATTCAAGTTACTGA
TATTGGTGATTCCTTGTAGGGGAAATTGGAAGATGGGAAAGAAATAGCTGTCAAGAGGCT
CTCAAAAGCCTCGAAACAAGGGCTGGAGGAGTTCATGAATGAAGTGTTGGTGATCTCGAA
AGTCCAACATAGAAACCTTGTTAGACTCTGTGGATGCTGTGTCGATAAAGAGGAGAAGAT
GCTGATTTATGAATATATGCCAAAGAAAAGCTTAGATGTGTTTCTCTTTGATGAAGCACA
TCGAGACATTTTGGATTGGACAAAACGTTCCATTATAATCGAAGGAGTTGGTCGAGGACT
CCTTTATCTACACAGAGATTCAAGATTGAAGATAATTCATAGAGATCTAAAGCCAAGTAA
CATCTTGCTCGATAATAACTTCAATCCAAAGATTTCAGATTTTGGCATGGCTAGGATTTT
CGGATCTGATCAAGATCAAGCAGACACAATGAGAGTAGTTGGTACTTAGTAAGTGATCAT
TTATCTATATACAATACCATAACTTTGCATAATTTAACTACTCGAATCGTACTGACATAT
TTACAGTGGATACATGGCACCCGAATATGCAATGGAAGGAAGATTCTCAGAGAAATCCGA
TGTTTTCAGCTTTGGAGTTCTAGTCTTAGAGATCATAAGTGGTCGAAAAAGTACAAATTC
TTGGACTGAGACATCCTCTTTGAGCCTTTTGGGATATGCATGGAAGTTATGGAAAGAACA
AGATTTATCAACTTTTATCGATCCGTTTATATTGAATCCGAGCTCGGAAATAGAGATCAG
AAAATGCATACAGATTGGTTTACTATGTGTACAAGAATTTGCTGAAGACAGGCCAAGTAT
TTCATCTGTTCTTGTTATGCTTACTAGTGAAACAACAAGTCTTCCAGCACCATCACAACC
TGCTTTTACTGAAAGAAGACACTTCAGAATGTGCAATGAAAATAGAGAAACTAAGTTTAC
TTTGAACAAAATGAGTATCACAAACCTTACTGGTAGATAACATGAGCATATGAAATTACT
TTTTAAAGATTTGCACAATTGTTATAGTATGATCCATTCGTCTCAATTTGTATGATACCT
TTTGTTTCAAAATGTTTGACAATATTGGGTCCGTGTAAAG