Microarray Probes on PGSC0003DMT400073563

Probe IDChipProbe Sequence
CUST_40782_PI426222305 JHI_St_60k_v1 AACACAAAGCAATCTTGCATTCTGTTTTAGGTAACGGTCAGTGAATAGCCATAACTAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073563

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073563 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G13920.1 +2 3e-105 353 296/875 (34%) receptor like protein 50 | chr4:8043861-8046536 FORWARD LENGTH=891

Transcript Sequence (3148 bp)

>PGSC0003DMT400073563 3148 pgsc_dm_v3.4
TAGTATTTAAAATAGGCAAAAAAAATTGATCTGTTAGCCAAAAAAATAAATACAAACGAA
TCCTGTTGTTTATTTGCGAGGATTTTGCTATTTTATACGTTTCAGATCTGCAGAAATTTG
GAGTTTCTTTTTTCTGTTGACAGTCCAAATGAGAAGTGAAATGTTTTCCCATCTTTTCTT
GATCCTATTACTCTCCATCTGCTGTAAAATGAGTGATGTAGTGGCAGCTAATTCCAGTAA
ATGTCTTGAGGATCAGAAGAAGTTACTGCTGCAGCTGAGAAATAAGCTTACTTATGATTC
TGAAATATCTACCAAGCTAGTGAAGTGGAACCAGCGGATTGACTGCTGTCAATGGGAGGG
TGTCACTTGCAACGGTGAAGGCCAAGTTATTGGTCTTGACCTTAGTGCTGAATCATTCTC
GGGCAGTATCACTCCGTTAGCTGATCTTAAGTTTCTCTCTATTGTCCATCTTGATGGGAA
CAATTTATCTGCACCAATTCCAGAGTTCTTTGCGGAATTCACCAATTTAACTGTCTTGAG
TCTGAGTTCCTGCAACTTGATAGGAGAGGCACCTCAGAAAATATTCCAGGTACCAACTCT
GCAAACAATTGACTTATCAGTAAATAGGATGCTTGGGGGTTCTTTACCTGAATTTCCTTC
AAAAGGATCTCTACAAAACCTGGATCTTAGTTATACGAAATTTTCAGGAAGTTTACCTGA
GTCCATAGGGAACCTTAGGAAGTTGTCGCGTGTTGAACTTAGAGCTTGTAATTTTACAGG
TCCAATTCCATCTTCTATGGAAAATCTAACCCAGCTTGTTCTTCTGGATTTCAATTTGAA
TAGCTTCACGGGTTCATTTCCATCTTTTAAGCTGTCCAAAAATCTCACTGATATATACTC
TGCTAGAAATCGTTTGATAGGAATATCATCAGACTGGGAAGGCTTTGAGAATCTTGAGTA
TCTTGACTTGAGTAGCAATTCAATTTCTGGGATCATTCCAGAATCATTGTTTTACCTACC
CTCACTTTCAGCTTTAGTTCTGTCCAACAACAAGTTTTCTGGCCAAATAACTGAATTACA
AAATGTGATTTCTCCACTTAAAAGTCTTGAGTTGAGTTCCAACAAATTGGAAGGGCCAAT
ACCTGAGTTTTTATTTGAGCTGCATGATCTTTATGGTCTGTCACTTTCATTCAACAAGTT
TAACGGTACTGTGCAGTTGAAGAAGTACACAAAGATCAATAAACTTGTAGATCTTGATCT
GTCCCACAACAGTTTATCAGTTGACACCAATATAAGTGAATCGGACCTTGCCTTGCTACC
CCAGCTAAATAGTTTCATGTTAGCGTCATGCAATCTGCAGAATATTTCCTTCCTCAAGAA
CCAATCAAAGTTGTCGATGTTAGATCTCTCAAACAACCAGCTTACTGGTGAAATACCAAA
CTGGTTGGTGGAAATCAATGATGGACTTCTCCGTTTTCTGAATCTTTCTTTCAATCAATT
TACGCGTCTTCAAGAACCATATACAATTGGCTTTCTCATGAATTTCCTTGATCTGCATTC
AAATCTGCTCACTGGGGTTATTCCATTACCACCACGTGCAGCTGCTTATATTGACTTCTC
AGACAATAACTTTTCATCTTTTCCACCTGACTTTGGCAATTATCTAGTAACTGCTCGGTT
CCTCTCAATTGCAAACAACAAAGTTATCGGTAGTATCCCTTCTTCGATATGCAACTCCAG
CTATCTTGAAGTACTTGAGTTATCAAACAACAGTTTGAATGGCATAATACCACCATGTTT
AGCAGAAAAGAGCAGCACACTGAAAGTACTGAACCTGGGAAAGAACAATCTCATAGGAGA
TATACCTGAAAAGTTTTCTTATAATTGTGAGTTGCAGAGCCTTGACCTCAGTCAGAATCA
CTTAACAGGTCTGCTTCCTCGTTCTTTGTCCAACTGCACAAAGTTAAAGGTAATAAATAT
TGGAAACAACAAGATCAAGGATACTTTTCCCTGCTGGTTGAGGAACATGTCAGATCTTCG
TGTACTTGTATTACGCTTCAATGGTTTCCATGGGAACATTGATTGCTCACGTGTGAATTC
CAACTGGACTGCACTTCAAATCATGGACCTAGCTTCCAACAATTTAGGGGGTGTTCTTCC
CCGAGGTTCATTCTTGGAGCTAAAAGCAATGATGGCTGACCCATCTTTAACACATTCACG
CTCTGATATCTTGCATTTTGAGTCTTCTATTAGGCCAATATATTATCAGGACAGAGTCAC
TCTTTCTCTTAAAGGACAAGATGTTACACAGACAAAGATCTTTATCTTCTTCACCTCCAT
TGACTTTTCAAGTAACAATTTTGTGGGGAACATACCAGAGATAGTTGGAGATCTCAGATC
ACTTAATCTTCTCAATATTTCACACAACAATCTCACGGGTCAAATACCTCCAGCAATTGG
AAATTTGAAGCAATTGGAATCACTGGACCTCTCATTCAACAAGTTAGGTGGCAATATCCC
AGAAAAGCTTGCTAGCCTCACATTTCTTTCCTTCTTAAATTTATCATCTAATGAATTGGT
CGGAATGATTCCACGAGGCAACCAAATTCAAACATTTGGAGAAAGTTCTTTTGAAGGAAA
CAAGGGGCTATGTGGGTTTCCGCTGAACAGAACTTGCAAGAATAATTCAGCAGATGCACC
TTCTGAACCAGAAGTTGAAGAGGAAGAATTCATTTCAATGACGGAGATTTATGTAAGTGC
TATGTTGGGATTTATTGTTGGTATTGGGATCATCTTCCTACCACTTCTGTTCTCAAAAAG
ATGGAACCAGTCGTACAACAGAATAATTAACAGATTAATTTTAAGGATATTTCAGCAGCA
AAATCAAGAAAAGAAAACTAGTAGCAGTAGTGTAGCATCTTGGAAAAAGGCAGCAGGGAA
ATCAAGAGGCAGACATTAATTTCACAGGATGTAACACTTCCTTGCAGCATGCTGCTCACT
ATTAGTACTTCTAATTGTTTCCACTATGAGTTATCTGTGTTTGTTTACCTTTCATGATTC
ATTTTAGTTGCTTCTTATTACATAGAAGAACACAAAGCAATCTTGCATTCTGTTTTAGGT
AACGGTCAGTGAATAGCCATAACTAAAC