Microarray Probes on PGSC0003DMT400072748

Probe IDChipProbe Sequence
CUST_19271_PI426222305 JHI_St_60k_v1 CATGATATTGCTGAATGCCCATTTTTGTTACTGTTTGAGATGACAGGAAATTTTCAACAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400072748

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400072748 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G26340.1 +1 2e-54 175 95/134 (71%) cytochrome B5 isoform A | chr1:9113992-9114755 FORWARD LENGTH=135

Transcript Sequence (746 bp)

>PGSC0003DMT400072748 746 pgsc_dm_v3.4
TTTTAACTCTCCTATTCAAACTTGAAGATAATTGGCTCCTTGCACAGATTTTTGAGAGAA
ATTTTGCAAGTAAAAATGCCAACTTTAACGAAGTTATTCACAATGGAAGAAGCTGCTGAG
CACAACACTAAGGATGATTGTTGGGTTGTCATTGACGGCAAGGTATATGATGTTTCATCT
TATTTAGACGAACATCCAGGGGGAGATGATGTTCTACTTGGTGTTACAGGACAAGATGCC
ACTGATGAATTTGAAGATGCTGGACATAGCAAAAGTGCGAGAGAACTTATGGAGAAATTC
TTCATTGGGGAGCTTGATACAACATCCTCTTCCATCCCGGAACTTGAGATTGTCAAGAAG
GCGGGCAAAGATATTCCTCAAAAGTTTATGGAAGTTACTAAGCAATATTGGTTCGTTCCA
GTAGCAGCTGTTGGCATCTCTGTGGTGGTTGGCTTCTTGTACACACGCAAGAAGTAAAAT
CAGTTCGATATTCCATCTTAGATGTTAGTAATATTGTGCAACATAGACTGAATTTTTTTT
TCGTCATATCTTTGGAGGTCCAGGAATTTGGGACATGATATTGCTGAATGCCCATTTTTG
TTACTGTTTGAGATGACAGGAAATTTTCAACACCAAATTATTCACAAATAGGCATTTGAA
TACACAGTTGCTATCATTTTGTAGTTGATAAAGAGTTTTCATTTATTACCTTTTTGAGGA
TATATAATAAAGCACTCAGAAAGGAC