Microarray Probes on PGSC0003DMT400070925

Probe IDChipProbe Sequence
CUST_33783_PI426222305 JHI_St_60k_v1 CAGTGAGTAAAACACATGCTGCTCTATTTCTTTTGTTCATGGGATTTCATCTTACATAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070925

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070925 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G51100.1 +2 3e-68 225 117/206 (57%) Fe superoxide dismutase 2 | chr5:20773357-20775635 REVERSE LENGTH=305

Transcript Sequence (1648 bp)

>PGSC0003DMT400070925 1648 pgsc_dm_v3.4
AATTACATCAACAAAAGGGCAATGCAATGCTAGTCTAGAAAACTCCACACTCTGCTTATT
TCTCCAACTTTCTGTAACCTTTTTACACAAATCACAACTCATGGCCGCCACTGCCTCTGC
TAATTCACTCACATCTGCTTTCCTTCCTCCTCAAGGACTTAATGGATCATCTAAGAGCTT
ACAATGGAGAACCCAAAAGTTGCAGAAACAGTTTGGAAGAAAATCCGACTCTGCTACAAT
AACAGCTAAATTTGACCTCAACTCTCCTCCTTATCCAATGGATGCTTTGGAGCCTCATAT
GAGTAGTAGAACATTTGAATTCCACTGGGGGAAGCATCACAGGGCGTATGTCGACAACTT
AAACAAGCAAATAGAAGGAACAGAATTAGATGGAAAGACACTAGAAGATATAATACTTGT
TACATATAACAAAGGTGCTCCCCTTCCAGCATTCAACAATGCTGCTCAGGCCTGGAATCA
TCAGTTCTTCTGGGAATCTATGAAGCCCAACGGAGGAGGAGAGCCATCTGGTGAATTATT
AGAACTAATCAACAGAGACTTTGGTTCTTATGATACGTTTGTTAAAGAATTTAAGGCAGC
TGCAGCAACACAATTTGGCTCTGGTTGGGCCTGGCTTGCATACAAACCTGAAGACAAAAA
GCTTGCTCTGGTGAAAACTCCTAATGCTGAAAATCCTCTTGTTTTGGGTTACACAGTGAG
TAAAACACATGCTGCTCTATTTCTTTTGTTCATGGGATTTCATCTTACATAACATAGCAG
TTTATACTGTAATAGAAATCTCACAACTGTGGTTTTCATTGCAGCCGCTGCTCACCATAG
ATGTTTGGGAGCATGCCTACTATCTGGACTTTCAGAATCGCCGACCTGACTACATATCTG
TCTTTATGGAGAAACTCATATCATGGGAAGCAGTCAGTTCTAGGCTCAAAGCAGCAACAG
CTTGAGCTGCTTAGCAGGAAAACAGAAAGGATGAAGAGGCAAATCTAGGAGGCACTGAAG
ATGTATGCTGGGAGTTACATACTTGAGGCAGAATGATTTTTGTCAACACTATGATCAATC
CTGTTATATTTCCTTTTCAGTGAGAGTTCTAGATGTCTTAGCTGAGAATTTGAGATGTTT
TATTTTATGCACTTTGCAAGAGTGACAGGTGATTTTCTAAATTCAGATGACAATATTGTT
TATGTTCTCAAGTAGTTGATGGCTGGGGAAATAATACAGAAAATCAAGTTTGAGTTGTAG
AACAACAATGTACAAGGAATTGAATAAAGATATTTATTGCACTTTGATGCTCTAATATCA
GATTGATTCAATGACTGGTAAAGTAAAATAGGGCCCTTACTTACTTCAGAATCTGCTATA
TGGAACAAAGGGCATCCTACCAATTGAAGACTTGATCCAATATTCCCTTTTTCCAAGTTA
GAAATTGTTTCACATCACATTTAGAGGTCGCAAAAGTAGTCCATGAAAACATGATCTACC
CAACTCGTTCAAGTTTGGGTGGTTAGTGACTAGCTAAAGGCTTCTAAAAGAGCGCTCACT
GATAAAGGAGGCTTCTAAATGAGACGACAAGAAGGTTAGCTTAAAGCAGCTATTTTTGAA
CAGTTAGTACTTGAATAATAGTTCACTG