Microarray Probes on PGSC0003DMT400070176

Probe IDChipProbe Sequence
CUST_21503_PI426222305 JHI_St_60k_v1 TTTGGTCTTCCAGACAACAGAAGAATGGTTGAACAGCACTTTGGGGTTGCACCCAATTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070176

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070176 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G13630.1 +1 0.0 2360 1190/1383 (86%) magnesium-chelatase subunit chlH, chloroplast, putative / Mg-protoporphyrin IX chelatase, putative (CHLH) | chr5:4387567-4392082 REVERSE LENGTH=1381

Transcript Sequence (4424 bp)

>PGSC0003DMT400070176 4424 pgsc_dm_v3.4
GTTTTCTTGGTTTTTGTGTACATTTTGTGTGTAATCAAGAAGCCAAAGAGGTTAAAGTTT
GAATCTTTTTCAAGTTTTTGAACTATGGCTTCTTTGGTTTCTTCACCATTTACATTGCCA
AACTCAAAAGTAGAACACCTTTCATCAATTTCTCAAAAGCATTACTTTCTTCACTCTTTT
CTTCCCAAGAAAACAAACCCCACCTTCTCAAAATCACCCAAAAAGTTCCAATGTAATGCT
ATTGGAAATGGCTTGTTTACACAAACAACTCAAGAAGTTAGGAGGATTGTACCAGAAAAC
CTTAAAGGTCTTACTACTGTGAAAATAGTGTATGTGGTGTTGGAAGCTCAGTACCAATCA
GCTCTTACTGCTGCTGTTCAGACACTGAACAAGAATGGTGAGTTTGCTTCTTTTGAGGTT
GTGGGGTATTTGGTTGAGGAGCTTAGAGATGAAAATGCTTATAAAACTTTCTGTAAAGAT
CTTGAGGATGCAAATATATTTATTGGGTCATTGATTTTTGTGGAAGAATTGGCTTTAAAG
GTTAAGTCTGCAGTGGAGAAAGAAAGGGATAGGCTTAATGCTGTTCTTGTGTTTCCATCA
ATGCCTGAAGTGATGAGGCTGAACAAGTTGGGATCTTTTAGTATGTCTCAGTTGGGGCAA
TCAAAAAGTCCATTTTTTCAGCTTTTCAAGAAGAAGAAATCTTCTGCTGGTTTTTCTGAT
CAGATGTTGAAGCTTGTGAGGACATTGCCTAAGGTCTTGAAGTACTTGCCAAGTGACAAG
GCTCAAGATGCTAGGTTGTATATACTAAGTTTGCAGTTTTGGCTTGGAGGTTCACCTGAT
AATTTGGTGAATTTCTTGAAAATGGTGTCTGGTTCTTATGTTCCTGCATTAAAAGGGGTG
AAAATGGACTATTCGGATCCGGTTTTGTACTTGGATAGTGGAATTTGGCATCCTTTGGCT
CCTTGTATGTATGATGATGTGAAGGAGTATTTGAATTGGTATGCAACAAGGAGGGATGCT
AATGAGAAACTCAAGAGTTCTAATGCTCCTGTTATTGGGCTTGTTTTGCAAAGGAGTCAT
ATTGTTACTGGTGATGAAAGTCACTATGTGGCTGTGATCATGGAATTAGAGGCAAGAGGG
GCTAAAGTTATCCCAATTTTCGCCGGGGGGCTAGACTTTTCCGGGCCAGTTGAGAGATAC
TTCATTGATCCCATCACAAAGAAGCCTTTTGTGAATTCAGTAGTATCACTTACTGGTTTT
GCTCTTGTTGGAGGGCCAGCAAGACAGGATCATCCAAGGGCTATCGAGGCGTTGATGAAG
CTTGATGTGCCTTACATTGTGGCATTGCCTTTGGTCTTCCAGACAACAGAAGAATGGTTG
AACAGCACTTTGGGGTTGCACCCAATTCAGGTGGCTCTACAAGTTGCTCTACCTGAGCTC
GATGGAGGCATGGAGCCTATCGTATTCTCTGGACGGGATCCAAGAACAGGGAAATCACAT
GCTCTTCACAAAAGAGTGGAGCAGCTATGCACCAGGGCAATCAAATGGGGAGATTTAAAG
AGAAAATCAAAGGCTGAGAAGAAGTTGGCAATCACTGTTTTCAGCTTTCCCCCGGACAAA
GGCAACGTCGGAACTGCTGCATACTTGAATGTCTTTGCCTCCATATACTCTGTGCTCAAA
GATCTCAAGAAAGACGGGTACAACGTTGAGGGGCTGCCTGAGACTTCTGCTGAACTGATT
GAAGAAGTAATTCATGACAAAGAAGCTCAGTTCAGCAGTCCAAATCTTAACGTAGCTTAC
AAGATGAACGTCCGAGAATACCAGAAGCTAACCCCCTATGCCACTGCTCTTGAAGAGAAC
TGGGGGAAAGCACCTGGTAATCTGAACTCTGATGGAGAGAACCTCTTGGTATATGGAAAA
CAGTACGGAAATGTATTTATTGGTGTTCAGCCTACATTTGGATACGAAGGTGACCCGATG
AGACTTCTGTTCTCCAAATCAGCCAGCCCTCACCATGGTTTTGCTGCATACTATTCCTTT
GTGGAGAAAATTTTCAAAGCTGATGCAGTTCTCCACTTTGGTACTCATGGTTCTCTTGAG
TTCATGCCAGGAAAACAGGTGGGAATGAGCGATGCTTGTTTCCCAGATAGTCTCATTGGA
AACATTCCAAATATCTATTACTATGCAGCAAACAATCCATCCGAAGCAACCATTGCCAAA
CGAAGGAGTTATGCGAATACCATTAGCTACTTGACTCCCCCAGCTGAGAATGCTGGACTC
TACAAGGGACTCAAGCAGCTTAGTGAGCTCATTGCGTCGTACCAATCACTGAAAGACTCA
GGCCGTGGCCCTCAGATTGTGAGCTCTATCATTAGTACTGCTAGACAGTGTAATCTTGAC
AAGGACGTTGATCTTCCAGATGAAGGACAGGAAATAGATGCCAAAGAACGTGACCTCGTG
GTAGGAAAAGTATATTCTAAGATTATGGAGATTGAGTCTCGTCTTCTGCCCTGTGGACTT
CACATCATTGGTGAACCTCCAACCGCCATGGAGGCAGTTGCTACTCTTGTCAACATTGCT
GCATTGGACCGTGCTGAAGATGATATTTCTTCCCTTCCTTCTATACTGGCTGCCACAGTT
GGAAGAAACATTGAGGAGATCTATCGAGGAAATGACAATGGAGTCTTGCGAGATGTGGAG
CTGCTTCGTCAAATTACTGAGGCATCACGTGGAGCAACATCAGCATTCGTTGAACGTTCA
ACTAACAGCAAGGGTCAGGTTGTTGACAATTCTGACAAGCTGACCTCACTCCTTGGTTTT
GGTATTAATGAACCATGGATCCAGTATTTATCAAACACCCAATTCTACAGAGCTGATAGG
GAAAAGCTCAGAGTCCTGTTTCAGTTCTTGGGAGAGTGTCTGAAGCTAATTGTGGCTAAT
AACGAGGTGGGAAGCTTGAAACAGGCTCTTGAAGGGAAATATGTTGAACCAGGTCCTGGA
GGGGATCCAATCAGAAACCCGAAAGTTTTGCCTACTGGGAAAAACATCCATGCTTTGGAC
CCACAGTCTATTCCCACAACAGCAGCACTGCAGAGCGCCAAAATAGTGGTTGAAAGATTG
TTGGAGAGGCAAAAGGTTGACAACGGGGGCAAGTACCCGGAGACTGTTGCTCTGGTGCTT
TGGGGAACAGATAACATCAAGACTTATGGAGAGTCGTTGGCACAGGTTATGTGGATGATT
GGTGTTAGGCCAGTTGCTGACACACTTGGACGCGTTAACCGAGTGGAACCAGTTAGTCTT
GAAGAGCTTGGAAGGCCTAGAGTTGATGTTGTTGTCAACTGCTCCGGGGTGTTCAGGGAT
CTCTTCATCAATCAGATGAATCTCCTTGACCGAGGAATCAAGATGGTTGCTGAGCTTGAT
GAACCGGAAGACCAAAACTTTGTCAGGAAACATGCACTAGAACAGGCAAAAACACTCGGA
ATTGATGTTCGTGAAGCAGCTACTAGGGTCTTCTCAAATGCTTCGGGTTCTTACTCTTCC
AACATCAACCTTGCTGTTGAGAACTCATCATGGAACGACGAGAAGCAACTTCAAGACATG
TACCTGAGCCGGAAGTCATTTGCATTTGACTGTGATGCTCCTGGTGTTGGCATGATGGAG
AAGAGGAAAGTTTTTGAGATGGCTCTAAGCACAGCGGATGCCACGTTCCAGAACCTCGAT
TCATCAGAAATTTCACTCACAGATGTTAGTCACTACTTCGATTCAGATCCAACCAACCTT
GTTCAGAACCTCAGGAAGGATGGAAAGAAGCCTAGTGCATACATTGCTGACACCACTACT
GCTAATGCTCAGGTACGTACGTTGTCTGAGACTGTGAGGCTAGATGCAAGGACAAAGTTG
TTGAACCCCAAGTGGTATGAAGGCATGCTGTCCACTGGCTACGAGGGTGTTCGTGAGATT
GAGAAACGATTGACCAACACAGTAGGGTGGAGTGCAACTTCAGGCCAAGTTGACAATTGG
GTGTATGAAGAAGCCAACACAACATTCATCAAAGATGAAGAGATGTTGAACAGGCTTATG
AACACAAATCCAAATTCTTTCAGGAAGTTGCTTCAGACATTCTTGGAGGCCAACGGGCGT
GGATACTGGGACACTTCTGAAGAGAACATTGAGAAACTCAAGCAGTTGTACTCAGAAGTC
GAAGACAAGATTGAAGGAATCGATCGATAAATGTATAGCTAAATATATGATCTCTGATTA
TTGCCTGTTTCTGTTACAGGATAATAAGATCCTTTCTGCTTCCTAACAATTTCTGATGTG
AATCCCTTTGATAGTCCCCAGTGTAATTTTTGTTCATTTTTTGGGGATGTCTTTCTACTT
TTATGAGAAAAATACTGCTTCCATATATTCAAATTTGATCTTGA