Microarray Probes on PGSC0003DMT400070026

Probe IDChipProbe Sequence
CUST_21493_PI426222305 JHI_St_60k_v1 GTTTGAAAACTTTAGTTGTAATATGATGTTTGTACCTCTTCTGTGAGGCAGTAGAAAGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400070026

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400070026 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G35370.1 +1 0.0 783 433/866 (50%) S-locus lectin protein kinase family protein | chr5:13588564-13591182 REVERSE LENGTH=872

Transcript Sequence (3703 bp)

>PGSC0003DMT400070026 3703 pgsc_dm_v3.4
CACAACCAAAAAGTTATGTTATGACTTTTGTGAGTTTGTCTTAAATCTAAATTTACAAAC
TCGAAAAAGTTATTGTAAGTAGCAGAGTGGCCTTGCTAGTACAATCCACTTATATGCTAG
GTAGCAGAGTAGATTGCTACCGCGATCAACTGAAATTCAGCTCTCTATTGCTCCAAAGAA
AACATTTTGACATGTGTAGTCTTGCTGTCAGGATCCACATAGAGATATCTTGGTTATCGT
GACCAATTGAGATTCAAACACTTTGTTGCTCCAGTGAACAAAAAAACATTTTCATAGAGT
AATCTTGCTGTCAGAATCTACTGAGATATCTTGGTTATCGTGACCAATTGATATTCAACA
CTTTTTTGCTCCTGTTCCATTTCATATAGTAAGTCTTGCTACCAAGATCAGCTGAGATTT
AGCTTTTTGTTGCTCCGATTCATTTTCTTGTTTCTATTAACAAAAAAATATTTTGATAGA
GTAATCTTGTTGTCAGGATCCACTGAGATATCTTGGTTATTGTGACCAATTGATATTCAA
CACTTTGTTGTTGCTCCAATTCCATTTCATATAGTAAGCCTTGCTACCAAGATCAATTGA
GATTCAGCTTTTTGTTGCTCCGATTCGTTTTCTGTTCTCCTTTTTCAAGTAAGTAAAGTA
GGTTGACTCGCTACTTTACCTTCTGTGTATAATGAGACGGAACAGAGTAAAAAATGCAAC
TTATAAGTATGGTATGCAAAAAGATTCTTGATTTCAAGAACTGATTTTTTTTTTCAAGTT
TTCATTGTTGTTAAGAGCATGGGATCATCTTTTTTGTTATTCATTGTTACCCTTTTGTTA
TCTTGTTTTCTTGTACACTCTGGACCTCTTTCTCTTCAACCATTAACTCCAAATTTCACT
GCTTCAAATTTCAAGTTCATTGATACTTCTGGATCATTCTTGTCATCACCAAATGGAACT
TTTAAAGCAGCAATAACAAACACAAAATCTCAAGAAAGATCCTATTACTTTGTCATTGTT
CACTCGGAATCACATGTAGTTGTTTGGTCAGCAAATCGCGATATGCCTGTATCTGATTCA
GGTGAGTTGCACCTTTCTGTCGATGGCCTTGCTCTTTTTGATGATTCAGGTCACACCGTT
TGGTCTGCGAAGCGTAGTAGTACTAGTAGTTCTGTTACTTCAATGCAGCTTCTTGAATCA
GGAAACTTGGTGTTGGTTGATGCTTTTAATAATACTGTGTGGGAAAGTTTTGATTCCCCG
ACAGATACAATCGTTGTAGGCCAACGATTGCCTGTTGGGAAATCGTTGGTTAGTTCAGTG
AACGAAGATGAAATTGCTAAAGGCGATTATAAACTTGTGGTTGTAGAGAATGATGCAATG
TTACAATGGAATGGAATGACTTATTGGAAGTTAAGTATGGAACCTAAGGCTTTTACTGAT
GCATATACTCTGGTGGAGTATATGATGATCAGTAGCAACGGGTTGTTCCTTGTAGGGGCG
AATGGGACGGAGAGAGTGATTCAGGTTATTTTGGATGAGGTGAAAGATCCTGACTTTAGG
ATTGCGAAATTGGAAGAGAATGGACATTTCGGTGTCAAACGATTCAGTAACGGAAATTGG
ATGTCTGAATTTGATAGTCCTATTGATAGTTGTCGTGTTGCTTTCACTTGCAAGAAGCTT
GGAGTTTGTGATGAGGGGAGCTGTTCTTGCCCACCGGGATTTCGTGTTAGTTCTGAGGTG
AATGGTAGTTGTGCTCCAGTTGATAGAAATCTGGTAATGCCAGTTTCTTGTAATGCATCT
TTGAATATGAATGTAACTGAATTGGGAAATCGTGTTTCGTACTTGAGGCTAGAGAATGGT
ATGGACTATTTTGCTAATGATTTTATCGAACCTGTGAAGCGTGGTGTTAATGTATCTGCT
TGTCAAGATCTTTGTTCTAAGAATTGTTCTTGCTTGAGTGTTTTTCATGATCAGTCGTCG
GGGTCATGTTATATGATTGAAAATTTTCTTGGTTCGATTTTGAGGGGCTCGGATTCTGGT
AACGGAAGAGGTAGATTGGGATACGTTAAGGTCATTTCTGAACCGTCATCATTTGATCCA
AATGACAACTCAAGTGACAAGAGGTCAAGATTACCCGTTGTTGCTTTGGTTTTACTTCCT
TCTTCTGGGCTTTTCCTGATCATTGTGATGATGGCTGGGATTATGTGGTTGATGAGAAGA
AAAAGATTGATGCAGATTTCAGGGAAAGAGTTTGGACGGACGGATTCTTCTTTGTTTGCT
GAGCTTGATAACATTTCCATACTGGGGTTGCCTGTGAAATTTGATCATGAGGAGATTCGG
GTAGCTACGGAGTGTTTTAGAAATCAAATTGGTACTGGTGGATTTGGAACAGTATATAAA
GGTACACTTTCTGATGGAGCTGTTGTTGCTGTCAAGAAGATGAATGCTCTCGGGGCTCAC
GGAAATAGGGAGTTTTGCACTGAGATCGCGATTATTGGGAGAGTTCACCATGTTAATTTG
GTCAGTTTGAAAGGATTTTGTGCACATAGGGGAGAAAGGTTTCTGGTGTATGAATATATG
AATCGAGGCTCATTGGATCGAACCCTTTTTGGACTTGGACCTGCCTTAGATTGGCATACC
AGATATGAAATCGCGCTTGGAACAGCACGTGGGCTTGCTTACCTGCATGGTGGTTGTGAG
CAGAAGATCATACATTGTGATGTGAAGCCAGAGAACATACTCCTCCATGACAACCTGCAA
GTAAAAATATCAGATTTCGGGCTTTCCAAGCTTCTTAATTCTGAGCAGTCTAGTTGGTTT
ACCACGATGAGAGGAACTCGAGGCTACTTAGCTCCTGAATGGCTGACTAGCTCAGCCATA
ACGGAGAAATCAGATGTCTACAGCTACGGAATGGTGCTACTAGAAATAGTACGAGGGAAG
AAGAACTCCTCGTTCCAACCACCAAATGACACTACTTCTCAAAGCGAAAGTAGTGAAAGG
AACAGGCTTTCTCCATCGTCTCTTGCCTCAGCAAATCAGCCAATCTACTTCCCATTATTC
GCGTTGGAAATGCATGAACAGAAAAAGTACCTGGAGCTAGTGGATCCTCGTGTTCTGGGG
AGTGTCAAAAGTGAGGAAGTCGAGAAGCTAGTACGTGTGGCTTTGTGTTGTTTGCATGAA
GAGCCAACTCTGAGACCAACAATGGCCAATGTTGTTGGCATGTTAGAAGGTGTGTTGCCT
TTGGCTACGCCACAGGTTCAATCACTCAATTTTCTACGATTTTATGGTCGTAGATTCACT
GAAGCATCAACTATCGATGGGGATCAAGAGGTTAATGTGTTTGAGTTACATCAACAAAGC
AGGAACCGTAGCAGTACTACTAGTAGCTCTTACAATTCCTTCTCTTATATGTCTTCACAG
CAAGTCTCAGGTCCAAGATAGCACTAGTAAATCAAACGTTGCTCAAACACTACAAAAATG
TTGTTACATTCGTGTCTGGTCCTCCAAAAGTGCATAGCTTTGGGAAGATCCAACCTACTT
TTGACATTATTTTTGGAGAGTCTAAACAACACGGAGTAAATCTGCTTTTTTAGTTCAATA
TGTTATGCTACTGTTTGAAAACTTTAGTTGTAATATGATGTTTGTACCTCTTCTGTGAGG
CAGTAGAAAGAGTATAAATATAAGTTGTAATTTATTCAATTTC