Microarray Probes on PGSC0003DMT400069033

Probe IDChipProbe Sequence
CUST_50804_PI426222305 JHI_St_60k_v1 CTCTTAGTCGATACTGTGTAATGATCGACTTCATCATATAAGGCCCCAACTATAAATAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069033

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400069033 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G12500.1 +3 8e-169 478 216/298 (72%) basic chitinase | chr3:3962501-3963984 REVERSE LENGTH=335

Transcript Sequence (1070 bp)

>PGSC0003DMT400069033 1070 pgsc_dm_v3.4
GTTACTACTACATCAAAATGAGGCTTTCTGAATTCACTACTCTTTTCTTACTATTTTCTG
TGCTTTTGCTGTCTGCCTCGGCAGAGCAGTGTGGTTCACAGGCTGGAGGCGCACTTTGTG
CCTCGGGACTCTGTTGCAGCAAATTCGGCTGGTGTGGTAACACTAATGATTATTGTGGTC
CTGGTAATTGTCAGAGTCAGTGTCCTGGCGGTTCTCCAGGGGACCTTGGCGGTGTCATCT
CAAATTCCATGTTTGATCAGATGCTTAATCATCGCAATGATAATGCTTGTCAAGGAAAGG
GTAATTTCTATAGTTACAATGCCTTCATCAGTGCTGCTGGGTCTTTTCCTGGATTTGGTA
CTACTGGTGATATCACTGCCCGTAAAAGGGAAATTGCTGCTTTCTTTGCCCAAACTTCCC
ATGAAACTACTGGAGGATGGGCTTCAGCACCTGATGGACCATACGCATGGGGTTACTGCT
TCCTTAGAGAGCAAGGTAGCCCGGGCGATTACTGTACACCGAGTAATCAATGGCCTTGTG
CTCCTGGAAGGAAATATTTCGGACGAGGCCCAATTCAAATTTCACACAACTACAACTATG
GGCCATGTGGAAGAGCCATCGGAGTGGACCTTTTAAACAATCCTGATTTAGTAGCCACAG
ACTCAATCATATCATTCAAATCAGCTATCTGGTTCTGGATGACACCTCAATCACCAAAGC
CTTCTTGCCACGATGTCATCACTGGAAGATGGCAACCATCTGGCACTGACCAAGCAGCTA
ATCGTGTCCCTGGATTCGGTGTCATCACAAACATCATCAATGGTGGCCTGGAATGTGGTC
ATGGAAGTGACAGCAGGGTCCAGGACCGAATTGGATTTTACAGGAGGTATTGTGGAATTC
TTGGAGTTAGTCCTGGTGACAATCTTGATTGTGGCAACCAGAGGTCTTTTGGAAACGGAC
TCTTAGTCGATACTGTGTAATGATCGACTTCATCATATAAGGCCCCAACTATAAATAAAT
TTATGTATGTACGAAATTGTATGAATTGTGATTGTAATATGATGGGACCA