Microarray Probes on PGSC0003DMT400068379

Probe IDChipProbe Sequence
CUST_40208_PI426222305 JHI_St_60k_v1 GTAATCCCTGCTGAATGGAAAGCTGGGATCACTATTGAGACAGATATTCAGCTCTCTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068379

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400068379 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G17030.1 +1 3e-75 231 110/207 (53%) expansin-like B1 | chr4:9581817-9583181 REVERSE LENGTH=250

Transcript Sequence (678 bp)

>PGSC0003DMT400068379 678 pgsc_dm_v3.4
ATGCAACTCAGACAGACGATAATTCGTCCTTTGTTTAGAGGTTCATGCAGAAGTGGAGCA
TGTGGCTACGGAGACTATGGCAAAGATGTGAATAGTGGCGATGTTTGCACAGCCTCCAAG
CGCCTTTACAAAAATGGAGCTGCCTGTGGAACTTGCTACCAGGTAAGGTGCAAGGACAAG
GATTTGTGCAGTGATGAGGGCACAAAAGTAGTTGTGACTGATAATGGAGAAGGGCATGGA
ACAGACTTCATTCTAAGCTCCCGTGGCTATGCTAAAATGGCAAAGCAGCCTAATATGGCT
CAGCACTTGTTTGCTAAAGGAGTGGTTGAAGTAGAATATCGTAGAGTTTCTTGCAAATAT
GGTGGAGGAAATCTCATGGTTAAAGTCCAAGAACATAGCAAGCACCCTAACTACCTTGCT
ATTCTTGTTATGAACCAAGGTGGTGCCACTGACATTCTCTCTGTCGAAGTCTTCCAGGAG
GAAACAAAAGAATGGATATCAATGAGGAGAGCTTATGGAGCTATATTCGACCTATCGAAC
CCACCAAGTGGTGAACTTAAAGTGAGGTTCCTCACAAGTGCTGGTGCTGAAACCAAATGG
GTGGAGTCTGATAAGGCTGTAATCCCTGCTGAATGGAAAGCTGGGATCACTATTGAGACA
GATATTCAGCTCTCTTAA