Microarray Probes on PGSC0003DMT400067833

Probe IDChipProbe Sequence
CUST_33640_PI426222305 JHI_St_60k_v1 GCTTGGAGTGCTAGGTTTTGCCTAAGGAACATGCTCTGATATTAAATTGTAAAGAGAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400067833

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400067833 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18390.2 +2 1e-167 507 298/640 (47%) Protein kinase superfamily protein | chr1:6327463-6329935 FORWARD LENGTH=654

Transcript Sequence (2702 bp)

>PGSC0003DMT400067833 2702 pgsc_dm_v3.4
TCTCAATTTGGTGTTCTCTTCCAAACCTCCTTTCTCTGTCCCTTAAATCCTCATCTCCTT
TCAGCTTAGCTCCTGAATAAAGCTCTTTTGCCACTATTACCAGTTAGCGCCTCTCTTTCT
AGGTGGTGCTAGTTCCCTTAATCAAACAGAAATGCATCCTTATTTTTTGCTCTTCACTAC
CACAATATTTATCTTGATCTATATACCCGGGTCTTTCTGTCAAGATGACGAGCGATACAG
GAGTTGTGGTGAGGAGTTTCGCTGCGGCAGCATGGATATAATTTACCCTTTTTGGGGAGG
GAGACAACCAGAGTATTGTGGTCATCCAAGTTTTGAGATCAAGTGCGAAAGTAACATACC
CAAAATTGCAATTGAATCAACAAGCTACGAAGTGATAAATATCAACGCTCCTAATCGAAT
TGTAACCCTGGCTCGGGATGATTTACTGAGTAGTATTTGTTTGGATAATCCTAAGAATGC
CTCCTTTGATTTAAACACTTTCAGCTATGTTTCTAGTGACCTGAATATTACTCTGTATTT
CCACTGCACCGTCCGCCCTGGTTTGCAATTACCACCTTCGCCTCCAAATAGGTTCAATTG
CGATAGCAACATGTTTGGTATATACACGCTGATCAACGTTCCCTTCGACCTTAGTCTGGT
AACATGCGAGGAAGAAATAATAGCTAGGGTCAATCAAACGAGTGCTGTGGCATTAGCCAG
TCCTACAGCTTCCGTGGATGCTCTGACAAGAGCCATTGCTGGCGGTTTTTCAGTTAATTG
GACGGCAGGTATTGACTCTAAGTGCCAACAATGCCGCACGTCAGGTGGAAGATGTGGATC
CAATCCAGATTCTGGAGACTTTGCTTGCCATTGTGTAAATGGTACTCATTCAAACGACTG
CTACGACGGACAAAACCAAGCCGGCGATAACCGAAAGAAAAATCAGATGCCACTTGCAGT
AGGCATTAGTGTAGGAGGTGCTGTACTTGCCAGCATTGGTGTTGGGTGGCTAGTCTTCTT
CTGCAGACAAAAGAGAAAGCGGATTGCATCACAGGCTTCACTTGCCCAAACCGAAAGGAA
GGATCTTCCAATTTTAAGTTCAAGCAACGGCCTGAGTTCCTCTTCTACTCCTTCTTCAAC
CACTTTCACCAGAAGCATTCCCTCTTATCCCTCTTCCAAATCTGAAGCTGATTACGGGAG
GGGAAGCTCCTACTTTGGGGCTCATGTCTTCAGTTTTGCTGAACTTGAAGAAGCCACGAA
TAATTTTGATCCATCTAAAGAACTTGGGGATGGTGGTTTTGGTGTCGTGTACTATGGCAA
ACTCCATGATGGTCGCGTGGTTGCAGTCAAGCGCTTGTATGAGAACAATTTCAAGCGTGT
GGAGCAGTTCATGAATGAAGTAGAGATTTTAACTCAGCTCCGCCACAAGAACCTAGTGAT
GTTGTATGGGTGTACATCTAAACGAAGCCGAGAGTTACTGCTTGTTTATGAGTATATACC
AAACGGGACTGTGGCAGATCATCTGCATGGTAAACGGGCCAAATCTGGCTTACTCTCTTG
GCCTATCCGAATGAACATAGCCATTGAGACTGCTGAAGCTCTGGCTTATCTCCACTCCTC
AGTTATAATACACCGTGACGTCAAAACCAACAACATTCTGTTAGACAATGATTTCCATGT
GAAAGTTGCTGATTTTGGGCTATCAAGACTGTTCCCAACTAATGTCACACATGTCTCTAC
TGCTCCACAGGGTACACCAGGCTACGTTGATCCTGAATACTACCAATGTTACCAGCTCAC
TGAAAAGAGTGATGTCTATAGTTTTGGGGTGGTCTTGGTAGAGCTGATCTCATCATTAGA
AGCTGTGGATACCAACAGGCACCGCCATGATATTAATTTGTCTAATATGGCTGTCAACAA
GATCCAAGGCCATTCAATACATGAGTTAGTTGATCCAAGTCTTGGATTCTCAACAAACAG
CTCCGTGAGGAGGATGACTACATTAGTCGCTGAGTTAGCTTTCCGATGTCTGCAACAAGA
GAGAGATCTGAGACCTTCAATGCAAGAAGTGCTGGAGACATTGAGAGGCATCCAGAATGG
AGAGTCGAAAGCACACAATGCTGAGGTACTGGATATTGTGGTAGATGATGTTGGGCTCCT
AAAGGAGGGCCCCTTTTCTTCTCCAGATTCAGTTGCCGCTGACAAATGAGTTGACAGCTC
CACACCACATTCTAGTGGATGAAATATCTTTATCAGGTTGGTTGAATTCAATGCTAGGTG
TGGAAGCAACTACTATTTTGGCACTTGTGATCAGTGTCATGTTTGGGCTAGTATCTCGCG
TCTTCCATAGATAATTAATTTCTTATTTTTGCTTACATATAGTTATCTTGTTATCGTCAA
TATTTTCTGTGGGAGATTATCTAAAACTGCTTTTCGCGTAAGGCAATGTATATAAATAGT
GAATAGGGCTGCCAACATTCTAGTATACATATGCATCTTTTGCTCTTTGTACATCAGGTT
TTGTTTCTTTACCGACCTTATGGTCCTTCTGTTACCTTAAAGTTCATTTATGTTGAGGAC
ATGAAAATCATATGTAACAACAATAATGCACTGCAGCAGAACATATTCTAAGCCTATTCG
TAGCTTGGAGTGCTAGGTTTTGCCTAAGGAACATGCTCTGATATTAAATTGTAAAGAGAA
AA