Microarray Probes on PGSC0003DMT400066535

Probe IDChipProbe Sequence
CUST_14756_PI426222305 JHI_St_60k_v1 GTGTTGTAAAAGTAAAATAAAGGGCATGTATTTGCTCCGTCCCGTAAATTGTTTTTGGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066535

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066535 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G14960.1 +2 4e-16 77 45/95 (47%) Auxin-responsive GH3 family protein | chr2:6451659-6453670 REVERSE LENGTH=590

Transcript Sequence (612 bp)

>PGSC0003DMT400066535 612 pgsc_dm_v3.4
GAAAAAAAAAACTTTCTTTTTCCCTCAAGTTTCAACAGTTACTTAAATTATATAAGCTTT
GGTAAATTACCCTCTTTTTTTACGTTGAAATATGACTATTAATTCTGTACTTTCATCTCC
TTTGGGTCCTTCTACAGGTGAGAAAGATGCAGAAATACTTCAATTCATTGAAGAAATCAC
TAAAATTGCTGATGTCGTCCAACAAAGTGTCTTGAATGAGATATTGACCCTAAACTTTCA
AATTGAATATCGTCAAAACTTTAAATCCAACATTCGGATAGTAACTTATGAAGATCTTCA
GGTGAAGATCCAACACACAAAATACGATGCAGATCCAGTCCCCTCTCAGCGGCGATTAGC
AGCAACGCCAAGGAAGATTAGAGAGAAGTGGGATTACAGGAGAAAGTAACCAAAAGAAGA
AGATGGGTTTGCAGTTTAATTAATTGCTACTATTAAAAATGATAATTTAAGTCCACACAG
TGTATTTGCTATTAAACCGTGTCTGTCGCTATATGTTGTAATTTTTCAAGCTCTCTGTGT
TGTAAAAGTAAAATAAAGGGCATGTATTTGCTCCGTCCCGTAAATTGTTTTTGGAAAAAT
TACTTAGATAAA