Microarray Probes on PGSC0003DMT400066405

Probe IDChipProbe Sequence
CUST_14662_PI426222305 JHI_St_60k_v1 CAACAACTTTTTACTACTCTTCTCCATATTGCCAATTCACATGCCTGATTTTAGTCCTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066405

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066405 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G23610.1 +2 2e-67 218 121/265 (46%) methyl esterase 3 | chr2:10044410-10046403 REVERSE LENGTH=263

Transcript Sequence (1252 bp)

>PGSC0003DMT400066405 1252 pgsc_dm_v3.4
GCTATGATAAGATGCCTCATTATATTATCCAAGATTAGAGCACTCCACAAGCCATCACAA
TTAGGTAAAAATGTTCTTTCTTTCTTTTCCAATAAACTTGTAACTTCAATGATTTATTTA
TTTTGTATAGGTTGGTGGTGAGGCAACAATGACAACATTTTCAGCAGCAATAGTAAGTCC
ATCAGCCATTATAGGCACAGGAAGAAAATCTTTCTACAAAAGAGCCAAAGTGACGAACAA
AATTAGTGGATTGAACTTATTTGGAAGTGAAAAGGCAAATAAGCATGTTGCCTCATTAAG
CCTCACTATGTGCTCACTGAAAACCCCATCACTAGGTGCAAAAAGCTTGTCACAACCCAA
AGCTAAGAAGCACTTTGTGCTACTTCATACGGGATGTCATGGAGCCTGGTGTTGGTATAA
GATTGTAGAATTGATGAAATCTTCAGGGCATAATGTTACAGCTCTTGACTTGGGTGCTTC
AGGAACCAACTCCAAACAGGCCCTCGAAATCACAACTTTTTCTGATTATTTGAGTCCGCT
AATGAAGTTCATGGCTTCACTTCCTGCACATGAAAAAATAGTTCTGGTAGGCCATAGCTT
TGCTGGACTCGGCATCTCTAAAGCCATGGAAAATTTTCCAGAAAACATTTCAGTTGCTGT
ATTTATCGCTGCTTTAATGCCTGGTCCAACTTTCAATGTAACTACAGTCTACACTAAGAC
ATGTAGTGCAATAATACCTGAACTTGATAATCACGTTACATACGACAATGGACCTGGGAA
TCCTCCAACCACACTCATCCTAGGTCCCAAGTTCATGGAAACTAATCTTTACCAGCTGAG
CCCAATTAAGGATTTGAAGCTGGCTACTAAATTAGTAAGACCGCTATATTTATATCCTGT
GGAAAATATTTATGAGGAGATAGTTCTTTCAAGAAAAAGGTACGGATCAGTTAAGCGGGT
ATTCATTATTGTTGCTGAAAGTAAAGCTCTGAACAAAGAATTTCAACATTGGATGATTGA
AAATAATCCACCTGATGAAGTGGAAGAGATTTTAGGCTCTGATCACATGGTCATGATGTC
TAAGCCTCAACAACTTTTTACTACTCTTCTCCATATTGCCAATTCACATGCCTGATTTTA
GTCCTAGTTAATTTGATAATTCAATCATTTTATTTTCGTTGTTATTTCCTTTTATTGTAG
TTTCAGTGTTTGAAATTGACATTAATAAATAATCTTGTTGCCTTGCTTCTGA