Microarray Probes on PGSC0003DMT400066343

Probe IDChipProbe Sequence
CUST_14704_PI426222305 JHI_St_60k_v1 GCGACTCTTCTGATTCTGGCGGGAATGTTCACAGCTTTTAAGCTTCCCGTTACTAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066343

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066343 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34410.1 +2 4e-30 117 87/206 (42%) redox responsive transcription factor 1 | chr4:16451992-16452798 FORWARD LENGTH=268

Transcript Sequence (1013 bp)

>PGSC0003DMT400066343 1013 pgsc_dm_v3.4
CTCAATTCAACTAGAAAAATAAAATAACTATCTGAAACTTAAAAGACCAAAAATTTCAAC
TATGCATTGGTTAAATAAGAGATTTAGACCGACTTCGAATTTGAATTCGAATTCCCTCCA
AAATAACAATCAATTTCAGCAGCAGCAACCAAGGCTTACTGGAGATGAAGAGTACTCTGT
TATGGTTGCAACTCTGAAAAATGTCATCAATGGTAATATTCCAGTGCAAAACAATCAAGA
ATTCAATGTCTTTTCGCCATACAATTATTCTACTGCCACCACTACAACCACCACCACGAC
TGTTACTTCCTCATCTTCGCCTTCTACTAGTATGTCCACGAGTTTCGAACAAGTATTGGG
TGTCCCTGCAGAACAAGAACCTTGTCAATTTTGCAGAATTCAAGGTTGTTTAGGCTGCGA
CATTTTTGGTACCACATTTTCTTCTTCTTCTTCTTCTGCGCCCGCTGCTGTGGCTGCTCC
TATTGCTGATAATAAGAAGAAGGGTAGTAGTACTACTACAGTCGCGATCGCAAAGAAAAA
GAAGAAGAATTACAGAGGAGTGAGACAGAGGCCATGGGGGAAATGGGCAGCAGAAATTCG
TGATCCTCGAAAAGCTGCACGTGTTTGGCTGGGAACTTTCACTACGGCAGAAGAAGCAGC
TAGAGCTTATGACAAAGCCGCCATTGAATTCAGGGGTCCACGAGCTAAATTGAATTTTTC
ATTTGCAGATTATACTGTTGACACTCAAGAACAACAGAGCACTTTATCTTCTTCACCACA
ACAATTACCAGAAGAGCCTCAGCAATCGCAGACAGCGAATAATAATTCGGATTTTGGAAA
TGAAATTTGGGATCAGTTGATGGGTGACAATGAAATTCAAGATTGGTTGACCATGATGAA
TTTCAATGGCGACTCTTCTGATTCTGGCGGGAATGTTCACAGCTTTTAAGCTTCCCGTTA
CTAAAAAAAGTCGAGTCCAACAATATTAAAAGAAATTAAGCTTCAGTTACTCG