Microarray Probes on PGSC0003DMT400066123

Probe IDChipProbe Sequence
CUST_14678_PI426222305 JHI_St_60k_v1 TGTGGGAGTTCCTGTTGATCCCCTTGCTTTTGCTGGACTTTTAGGTATGGTTGTTACATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066123

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066123 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17870.1 +1 0.0 703 401/496 (81%) ethylene-dependent gravitropism-deficient and yellow-green-like 3 | chr1:6150036-6152185 REVERSE LENGTH=573

Transcript Sequence (2055 bp)

>PGSC0003DMT400066123 2055 pgsc_dm_v3.4
GGGGTTCCAATTTTTCAATTTCATTGTCACCTTCTGTAGAACACAGTGCACCTGTACTTG
TTCTCCAACTTTCTAGATGTCTCTCTTTCACATTCCACTCGAAATCTGCTCTTCCTTAAA
TGGATTCCACAATGTTTTTCCATTTCCAAGAACTCAATTTCAGTTCAGAGCATTTTTCAT
CACACCCACATGGCAACTCTTTCTGCTACTTCATCTTCTTCTTCTTCTTGGTCCCTCAAA
AACAGGAGGCCGCATTACCTACCTCCTATTTCTTCAATTTCCAAAAACCCAATTTGCCGA
AATACCCTCTTCTCGTTTTCCTCGTACAACCCAAAAAGATTGAATCTTTATGTTCCTTAC
AAAAAAAGATTGAATTTTTATGTTAAAGCTGCCGAAGAAGATGAACCCTCATCTTCTTCT
TCTGTGGCTGTAGCTTCAGAAGAAAATGATTCTCCAAAGAATGATGCTCATATTCAAGAG
GGTGAGAGTGGTGCTCAGCATGAGACTGAGTCTGAGAGGATAGAGAGGGAGAAACAGCAA
GAAATGGATTGGAAAACAGATGAGGAATTCAAGAAGTTTATGGGGAATCCCTCAATTGAG
GCTGCTATAAAACTTGAGAAAAAGAGAGCTGATAGGAAGCTGAAAGAGCTTGATAGTGAA
ACCACTAGCAACCCACTTGTGGGCTTCTTTAAAAATTTGGTTCGTGTTAGTTTGTCCAAA
GAGAAAGAGAGGTTGGAAAAAGCAGAAGAAGCTTTTGTAGCTCTTGATCTTAATAAGCTA
AGGAATTGCTTTGGCTTTGATACGTTCTTCACGACTGATGTGAGGAGATTTGGAGATGGG
GGGATTTTCATTGGGAACTTGAGGAGGCCTATTGATGAAGTAATACCCAAATTGGAGAAG
AAGTTATCAGAGGCTGCTGGACGGGAGGTCGTCTTGTGGTTTATGGAGGAAAAGACAAAT
GATATTGTAAAGCAGGCTTGTGTGGTACAACCCAAGTCAGAGATGGATCTTGAATTTGAA
TCAACCAAATTAAGTACTCCTTGGGGATACATCAGTGCTGTATCTTTGGCCGTAACAACT
TTTGGCACTATAGCTTTGACCAGTGGTTTCTTCCTTAAGCCTGATGCTACGATTGATGAT
TACTTGGCCAATGTTGTACCCCTTTTTGGTGGCTTCTTGACCATTTTGGGAGTTTCAGAG
GTAACCACAAGAGTAACTGCTGCGCGCTATGGTGTCAAACTTAGTCCATCTTTTCTTGTT
CCGTCCAATTGGACTGGGTGCCTGGGTGTTATGAATAACTACGAGTCCCTGCTACCAAAT
AAAAAGGCTCTATTTGATATTCCAGTTGCTCGTACAGCAAGTGCATACTTGACATCGCTA
ATACTTGCAGTTGCTGCTTTTGTGGCTGATGGAAGCTTTAATGGAGGCGACAATGCATTG
TACATAAGACCTCAGTTCTTTTATAACAATCCGTTGTTCTCCTTCATTCAATACGTTGTT
GGACCATATACTGATGATCTTGGGAATGTGCTGCCTTATGCTGTTGAAGGTGTGGGAGTT
CCTGTTGATCCCCTTGCTTTTGCTGGACTTTTAGGTATGGTTGTTACATCTTTAAACCTG
TTACCATGTGGAAGACTAGAAGGTGGGCGCATTGCACAAGCTATGTTTGGCAGGAGCACA
GCTACATTGCTATCTTTCGCGACTTCCCTATTGCTAGGAATAGGTGGTCTAAGTGGAAGC
GTGCTATGTCTGGCATGGGGACTGTTTGCAACTTTCTTCCGCGGAGGAGAGGAAGTCCCA
GCACAAGACGAGATCACCCCACTTGGAAATGAGAGATTTGCTTGGGGTTGTGTACTCTTC
TTGATGTGTTTCCTAACACTTTTCCCTAACCTTGGTGGCACATTCTCTAGTTCATTTTTT
GGTGATCCATACTTCCGCGGTACTCTGTAATTTATAGTGTTGACTTGTACCAAATGTATA
TAAAGTTCTATTTTTTTGTTTGCTAAGATCAGTTAAGTTGTTCTCTCTTTACTATATATT
GAAGGTATAAATGCA