Microarray Probes on PGSC0003DMT400064988

Probe IDChipProbe Sequence
CUST_48638_PI426222305 JHI_St_60k_v1 CGCTAATTAACTCATGAGGTACTACTGTATCTTTGCATTTCTTCCTCCTTATATATATGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064988

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064988 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26670.1 +2 2e-131 394 206/319 (65%) Protein of unknown function (DUF803) | chr3:9798236-9800562 REVERSE LENGTH=441

Transcript Sequence (1592 bp)

>PGSC0003DMT400064988 1592 pgsc_dm_v3.4
GCAGTCCGAAGAAAGACCACATTTTAACTATACATATATAATTCGGTGTTTTATCAACGC
ATTCAATTGCCAGTACTCTGTCCATTGTGAACAATATCTGAGGCAGGGGGAAATTAAACT
ACCTGATTCAAAGAGAGTTCAATTGAATCAAGTTCATCGTAAAATTATATTGTGCCATCT
GAGTCTTCTAGCACACTGGCAAAGATGTTGGCTCAAAAATTGTTTTAGGTCGCAGGTTTG
TATTTTTTTAAAAAAATTTCCTTGTTAGAATTTCTGAATCCGCGAGTGTGTGTTTTATCC
ATCCATGGGGGATTGGGTAATTGGAGCGTTGATCAATTTGTTAGGAAGTGTTTTCATCAA
CTTTGGAACTAACCTTCTTAAATTAGCTCATGATGAGAGAAATTTAAGGGCTAGGATGAA
GCCCATTATATACTTCCAAGCATGGAGAATTGGTATTCTCTTCTTCACAATTGGAAATTG
TCTCAATTTCATTTCATTTGGTTATGCTGCTCAATCACTTCTATCAGCTTTAGGATCTAT
ACAATTCATCTCAAACATCGGGTTCGCGTACTTCGTGTTAAACAAAACAGTGACTATCAA
ATTACTGTTAGCCACTGCTTTTGTTGTTGCTGGAAACATTTTCCTTGTAGCCTTTGGTAA
TCACCAGTCCCCTGTTTACACAACAGAGCAATTGGGTGAAAATTACACAAACACTGTGTT
TCTCGTGTACTGTATCAGTTTGGTCTTAGTTGTTATTTTCCATCATTCAATTTACAAAAG
AGGAAAAGGGAAAATGCTGGTTCCATTTTCATATGCAGTTGTTTCTGGTGCTATTGGATC
GTGTTCAGTATTGTTCGCGAAGTCTCTTTCAAACATGTTGAGATTGTCAATGTCATCGAG
TGTTGATGGTGGTAGCGGTGGTGGTTATTCAACACTGCACAGTGGGTTCACGTATTCAAT
GCTCTTGATGTTTATAAGTACAGGTGGATTTTGGATGGCGAGGTTAAATGAAGGGCTATC
GCGATTTGATGCAATACTTATTGTCCCTATGTTTCAAATTGCTTGGACGTTTTTCTCAAT
TTGTACTGGATTTGTCTACTTTGAGGAATACAAGGTGTTTGATGCTTTAAGAACAACTAT
GTTCGTTTTTGGAATGATTTCTGTGTTTGTTGGCATTTATTTGCTAGCACCGGAGGATGA
TGAAGTATTGAAGGATGGTTCTTTAGAAGTGAAGAGGCTTTTCATGCCATCTGATCAAAT
TAGGGATATAGAGATCATTTGGACGAGATATGCTGATGAAAACTGCTGATATGATTGGAC
TACGCGAGCGCCAGGTCATTGGTGTGTGGTGACGGACATGACAATGGCACAGGCAATTAT
CTGTCTCGTCGAAAAATTATATTGTGTATATAAAAGCAACTTTTGTGTATATATACATTG
GTAATTTCCTTTTGATAGTAGTGAGGCTTCTATTGTAATTGGCAAAAGTAGCTTGAAATT
TTGTTTTAGGTCGCTAATTAACTCATGAGGTACTACTGTATCTTTGCATTTCTTCCTCCT
TATATATATGGAAAAAATAATCAACAATTCAG