Microarray Probes on PGSC0003DMT400063937

Probe IDChipProbe Sequence
CUST_31213_PI426222305 JHI_St_60k_v1 GCAAAGTATGTGTGTTCTAAAAGGCCCGAGTTTGCTTAACATATTGTGTAATAAACTACT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063937

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063937 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G77120.1 +3 0.0 643 321/378 (85%) alcohol dehydrogenase 1 | chr1:28975509-28977216 FORWARD LENGTH=379

Transcript Sequence (1749 bp)

>PGSC0003DMT400063937 1749 pgsc_dm_v3.4
ATAATGTACTCAATGTAATTTCAGATATGAACCTAATGAGGGTAAAATATGTGTAGATTT
TATGTCTACATGTCTTAGAGGGTAGAGGTTCTAGGAAAAACTAGGAAGTTGCATTAACTA
GGAAGAAGAAATTAGAAGATAGTAGTAACATGCGTATTTGGCATAATTGCATTAACTAGG
AAGTTGCCAAAAAAGAGAAGGTGTAATGAAGAAGACACGTGGTCAGAAAAGCAGAAATGA
AGGAGGTGTCCAAGTGTGTGTACACTTTGCCGAACAAATCCTAAGCCTTTTTGCCCTCAC
ACAATACTGACGGTGCGGAGTTATCAATTAGCCCACACTAATATATATACTCACTCAAAA
TAGAAGAAGAAATATTCACTTCATTCAACAAAACACCATTTTAAAAAAAAAGTTTAAGCC
ATAAACCAACAACAATGAGTACTGCTGGTCAGGTCATTCGCTGCAAAGCTGCGGTTGCAT
GGGAAGCGGGAAAGCCGTTGGTAATTGAAGAAGTGGATGTGTCACCTCCACAGAAACATG
AAGTTCGCCTCAAGATTCTCTTCACCTCATTGTGCCACACTGATGTTTACTTCTGGGAAG
CTAAGGGGCAAACACCTCTGTTTCCTCGAATTTTCGGACATGAAGCTGGAGGAATTGTGG
AGAGTGTAGGTGAAGGTGTAACAGATCTCCAACCAGGAGATCATGTTCTTCCTGTGTTCA
CCGGAGAATGCCAGCAATGCCGTCACTGTAAATCATCAGAAAGCAACATGTGTGAACTCC
TACGAATAAATACAGACAGAGGAGTTATGATTAGTGATGGTCAAACAAGATTTTCCAAGG
ATGGGAAGCCGATATACCATTTTGTTGGAACTTCCACTTTTAGTGAATACACCGTTGCTC
ATTCTGGTTGCGTCACCAAGATCGATCCACAGGCACCACTTGACAAAGTTTGCGTCCTGA
GTTGCGGAATCTCAACAGGACTTGGTGCAACTCTGAATGTTGCTAAACCTACTAGAGGTT
CTACTGTGGCTATTTTTGGTTTGGGAGCTGTTGGCCTTGCTGCTGCTGAAGGAGCTAGGC
TAGCTGGGGCTTCTAGGATCATTGGCATTGATTTGAATCCCAGCAGATTCAATGATGCCA
AGAAATTCGGTGTCACAGAGTTTGTGAATCCAAAAGATCATGATAAGCCTGTCCAGGAGG
TAATCGCTGAGATGACCGATGGAGGTGCTGACCGGAGTGTAGAGTGTACTGGAAATGTCA
ATGCTATGATCTCCGCTTTTGAATGTGTTCATGATGGTTGGGGTGTGGCTGTGCTTGTTG
GCGTGCCAAACAAAGACGACGCATTCAAAACTCATCCCATGAATCTGTTGAATGAGAGGA
CACTCAAGGGCACCTTCTTTGGCAACTACAAACCAAAAACTGACCTTCCATCTGTGGTGG
CCAAGTACATGAATAAGGAACTAGAGCTGGAGAAGTTTATCACCCATCAAGTACCATTTT
CAGAGATAAACAAAGCATTTGACATTATGCTGAAAGGGGAAGGCCTGCGTTGTATGATCA
CTATGGGACATTGAAATATGCTAAATAGGGAGAATAGGACAATGTATTATCCCCTATTAC
CTAGTAAAAATTATGTTAAGTAGAGTTTGAAGGCAAAGTATGTGTGTTCTAAAAGGCCCG
AGTTTGCTTAACATATTGTGTAATAAACTACTAATATTTGCATGTTTTGTAAGTCTTTTT
TGAGTTTTG