Microarray Probes on PGSC0003DMT400063916

Probe IDChipProbe Sequence
CUST_31226_PI426222305 JHI_St_60k_v1 ACAAGATTATAAAGGCAGATATGTTTTTTGATAGAGGAGAATTGCTTGGAGGACTTGTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063916

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063916 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G78780.2 +1 9e-54 173 81/156 (52%) pathogenesis-related family protein | chr1:29621447-29622431 REVERSE LENGTH=238

Transcript Sequence (510 bp)

>PGSC0003DMT400063916 510 pgsc_dm_v3.4
ATGACTTGGGAAATGGAAATAGTCCATAAGGCAGATCCTAATGAGCTCAAAACTATGGAT
CCAAACAAGTTCACAATTAGTGTTAATGGCCGAAAGGGCTTGACACCAGCAGAATCTGCA
AAGCTTGGTGGTAGCTACAATATATTCCTACAAACTTCATTACCAGAAAATGTTCGATTC
TACAATCCTGACGATCAAACTTTTGAATCATCACAAAATCTTTTCAGATCGATATTTTTA
CGAGGATTCGCGATCGAAATCCTCCATGTTTATTCAGGACCACCAGGAATTGTGTACAAA
TTTAGGCATTGGGGTTACATGGATGCTCCATTTAAAGGACATGCTCCAACTGGACAACTT
GTTGAGCTCTTTGGAATTGGCACATTTGAATTGGATAAAGAGAGTAACAAGATTATAAAG
GCAGATATGTTTTTTGATAGAGGAGAATTGCTTGGAGGACTTGTGAAAGGAGAAAGCAAT
GTTGCTTCAACATGTCCTTTTATGAAATAA