Microarray Probes on PGSC0003DMT400063850

Probe IDChipProbe Sequence
CUST_31166_PI426222305 JHI_St_60k_v1 TTAGAGAAGCCATATGAGAAGGAAATACCTAACACCCAAAGTGGTGATGCAAAAGTATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063850

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063850 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G21460.1 +1 3e-107 315 157/236 (67%) Nodulin MtN3 family protein | chr1:7512030-7513281 REVERSE LENGTH=247

Transcript Sequence (849 bp)

>PGSC0003DMT400063850 849 pgsc_dm_v3.4
ATGGCAATCATCAAAATTCTCCACACTTTGTTTGGGATTTTTGGTATGAGTTCTCATTTC
TATTTTTCACTTTACTTTTCTTGGATTTATATTATGGTTTCTTTTTTCATGACTTGTTCT
TATTTGTTTCTTGGAATAGGCAATATTACTGGCTTGTTTCTCTTCTTAGCTCCAATGATA
ACATTCAAGAGGGTTATTATGCATAAGTCAACAGAGCAATTCTCAGGCATACCATATGTA
ATGACACTTCTCAATTGCTTGCTCTCTACTTGGTATGGTCTGCCATTTGTGTCACCAAAC
AACATGTTGGTATCAATTATCAATGGCACAGGAGCAGGACTTGAGGCATTCTATGTGTTA
GTTTTCCTCATATTTGCACCAAAGAAGGAAAAAGCAAAAATCTCTGGAATTCTATGTGTT
GTCCTTTCTATCTTCTCAACTGTTGCATTGGTCTCAATGTTAGCTCTCCATGGCAATAAA
AGAAAGGTCTTTAGTGGCTTTGCTGCTGCTATTTTCTCCATCATTATGTATGGTTCTCCT
TTGTCAATTATGAGGCTAGTGATCAAGACTAAAAGTGTGGAGTACATGCCTTTCTTCTTG
TCCTTGTTTGTTTTTCTTTGTGGCACCTCATGGTTTGTCTATGGATTGCTTGGAAAAGAC
CCTTTCATTGCAGTACCAAATGGAGTTGGAAGTTTTCTAGGAACAGCACAATTGATATTG
TATGCCATTTATAGGGAAAACAAAGGACAAATCAAGAAAGGTGAGGAAGATGGAAGAGTA
GAGATGGAATTAGAGAAGCCATATGAGAAGGAAATACCTAACACCCAAAGTGGTGATGCA
AAAGTATGA