Microarray Probes on PGSC0003DMT400063716

Probe IDChipProbe Sequence
CUST_12438_PI426222305 JHI_St_60k_v1 GCCGAAGCTCTTAATCCGAGCTCGCTATTTTTTGTTCTTTTCTTTTGGTGTGTTTTCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063716

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063716 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G15920.1 +1 1e-60 198 102/203 (50%) Nodulin MtN3 family protein | chr4:9030742-9033343 REVERSE LENGTH=241

Transcript Sequence (1069 bp)

>PGSC0003DMT400063716 1069 pgsc_dm_v3.4
TTTTATGACTATGTTTCTGCAGGGAATGTCATCTCCATACTTATGTTCGCTGCTCCAATA
AAAACATTCAAAAGGATAATGAAGAAGAAATCAACAGAGGATTTTAAAGGGATACCATAT
ATCACAACACTATTGAGCACATGTTTGTGGACATTTTATGGGTTACTCAAACCTGGAGGT
TTGCTAGTGGTCACAGTCAATGGTACTGGTGCCATATTCCACATCATATATGTCACTCTC
TTTCTCATTTATGCTCCCAAACCTCTTAAGATTCAATCAATGAAATTGGTGGCAATAATA
AATATAGCATTTCTTGGGGCTGTAATAGCAATCACTTTACTAGCTGTGCACGGAACCACT
CGACTCACATTAGTCGGATTTTTATGCGCTGCTTTGAATATTGGCATGTATGCAGCTCCT
CTAGCAGCTACGAGGACAGTGATAAAGATGAAGAGTGTGGAATACATGCCATTTTTCCTT
TCCTTCTTCCAGTTCCTTAATGGAGGGGTATGGACTGCTTATGCAGTTCTTGTCAAAGAT
TATTTTATTGGAGTGCCAAATGGGATAGGCTTCATATTGGGTGCGGCCCAATTAATCCTG
TACTTCATGTACTACAAGTCAAGCCCAACAGAAGAAAAAGGCTCGGCCCATCTAATGAAA
AGAGAAATTCAAATGAAAGATGTTAATGGAGCCCATGAAAATGAGAACAATAGAAATCTT
CTTCACAAAGGGAAAAGTCTTCCCAAGCCATCATTAGTTCGTCAATATAGTGAAAGACTA
GTAAAGACTCTCTCAAATACCCCATCTTCTTTGGGCTCACACAATGTAAATGATATTGAA
AAAGGCCTCAAAGAAGCACACTAAATTTCTAATTTTATTCACCCAACTTTTTTCTTTCTT
CTTATTGGGCCTTTATATGTTGTAATGATAGCCGAAGCTCTTAATCCGAGCTCGCTATTT
TTTGTTCTTTTCTTTTGGTGTGTTTTCTAAATACACTATGAAATTTATGTAAGTTATACT
AATATAAATAATAAAATTTAATGTCCAGTTCAATGACTGACAATTTTAT