Microarray Probes on PGSC0003DMT400062883

Probe IDChipProbe Sequence
CUST_12717_PI426222305 JHI_St_60k_v1 TAGCTCAGCCCCTGGTGGTAGATTATATTGAATGATAATTATAAGTAGACTTGAAGATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062883

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062883 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62570.2 +3 2e-33 132 84/237 (35%) Calmodulin binding protein-like | chr5:25114934-25116967 FORWARD LENGTH=494

Transcript Sequence (1480 bp)

>PGSC0003DMT400062883 1480 pgsc_dm_v3.4
CAACCATCCCAAGGCAACGATAAGCTTGGAGATCTATTCATTTCTAATTTCATTCATAGT
TATTACATTGTTTTTCCGTATGATAGTGAGACCTGTATATGTTATTCAGAAAACTGCAGG
AAAAATTGAATCCAGGGCATTTAAAATTACAGTTTTCGAACAACGTGCGTGGTCCAATAT
ATACTGGGCTCCCCATAGGAGATCAAGAGGGCTCCCCCTTAGATCTACATTTAATTGACT
GCAGTACTCAAAATATTGTGAATCCTGGGCCAGAAGCAACAACAGAAGTGGAAATAGTTG
TCCTTGAGAAAGATTTTACAAGGTATGGTGGCGAAAAATCGCTGATTCGTGGAAATCCTC
GAGTCATCGTGAAAAATGGGAGTGTTTCTGTAAGTCATATTTCATTCAAACATACTAGAG
ATACTATGAGAAACCGTGAGTTGAGACTAGGTGCATTAAGAGTTGGGACCAGAATCGTGG
AAGCAGTCACTGAACCATTCTTTGTCAAGGATCGTCGTAACATAAGCAAGAGATTGAAGC
CCCTATTTCTTCATGATGAAGTTTGGAAACTGGAAACAATTGGCAAAAACGGTCCTTTCC
ATGAACGTTTGATGAAGGAAAACATTAAAACAGTCAACGACTTGTTAACTCACTACTTTT
TGAACCGTGAAAACCTACTCAAAATCCTTGGCAGGCATATGAACGTGGAGAAATTGGATG
CAGCAGTAAATCAGGCAAAGAATAAACTTGACTTGAAAAGATATGTGTATCCCCACGAAA
ATCCACTAGTGATATTTACTGATGTGGGAGAATTGACTGGAGTAGGACTGGAAGAAGAGG
GTCAGTTCTTCTCTGTCCAACAGCTCACTGATCAAACTCAAAAGGCTATTGCAATGGAAA
TGGTAAAAAAAGCCTTTCAAGAAGGCCGCCAGAATTTCAAGGTTTTATTGGATGATGATA
GTTTTTATAATGGATTCACTTCCGATGAGGCTTATAATTCTGTAATTGACACACAACAGC
TGCAACCAGTGCCTAATAATGTTGCTAATGACATGCCAAACACAAGTTTGATAGTGAATA
ATTATGACATTATAAGCCAAATCAATAGCTTATCCACAACTTCTACTGGTGAATTACCAC
ATCAATTTCATCCAGATGACAACGACTTCATCATCTACCAAGATCTTTCCCCAATCATCT
GGAATTAATTATTACATCAGGATTGTTTCATTAGTTAATTAATCTGTTATAGTCGGTGCT
GTGGTCGAGTCAGACCGAAGGATTTCAAAATATGAAGAAGTATGCATACGAAGAAATCAA
AGACAGATCAACATCAACTATATATATATTTTAACTACATAAAAATAGTATAGTATTTTC
CGCCAAAAGAGGTTCAGATGAAACTCGAAACCTTACTAGCTAGCTCAGCCCCTGGTGGTA
GATTATATTGAATGATAATTATAAGTAGACTTGAAGATCA