Microarray Probes on PGSC0003DMT400062645

Probe IDChipProbe Sequence
CUST_50936_PI426222305 JHI_St_60k_v1 CTTATAATTTTTGGCTGTGATCGCGAGTTCTAATAAAAGTACATTGGCAAGAGAGACAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062645

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062645 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38220.1 +2 1e-167 481 247/342 (72%) alpha/beta-Hydrolases superfamily protein | chr5:15269012-15271140 FORWARD LENGTH=336

Transcript Sequence (1539 bp)

>PGSC0003DMT400062645 1539 pgsc_dm_v3.4
TATTAACAGAAATATGAAATTCCAAGGATCAACATTTCTTTTCTCTAAAACGCGGCTCCT
CTTTCCCATTCACGCGCCGCCGTTCACCACCACATCATCTCTCACCGCCACCACCCATAA
CGTTACCGTCATCAGAAGGAAAAAGGATACTTCCATTTATGAATCATATGTTATTAATAT
GGGCGGTGTGACGTCATCCATCGCCGCTAAATTCGCGTTTTTCCCACCGAATCCTCCGTC
GTACACGGTTGTTTCTGACAAGGCATGTGGCGGTAAATTATGCATACCTGAGATACCTCG
GAGGGAAAACGTCGACGTTTTGAAGCTGCGGACTCACCGGGGAAACGAAATCGTCGCCGT
ATACGTGAAGCACCCAAAGGCATCCGCCTCTATGCTTTACTCTCATGGAAATGCTGCTGA
TTTGGGGCAAATGTTCGAACTGTTTGTTGAGTTAAGCCTCCGTCTTCGGGTCAATCTCAT
GGGGTATGATTACTCTGGATATGGACAGTCGACTGGAAAGACATCTGAGTGTAATACGTA
CGCGGACATTGATGCAGTATATAAATGCCTAAAGGAACAGTACGAGGTCAAAGATGAACA
GCTAATACTGTATGGTCAATCTGTTGGAAGTGGTCCAACTGTTGATCTTGCATCACACAC
ACCCAATTTAAGAGCTGTTGTTTTACACGGTCCAATATTGTCTGGTCTAAGAGTGTTGTA
CCCTCTCAAACACACACATTGGTTTGACATTTATAAGAATGTCGAAAAGATTAGCTTGGT
GAATTGTCCTGTTCTAGTCATCCATGGAACAGCAGATGAAGTTGTTGATTGCTCCCACGG
GAAACAACTCTATGAACTGTGCAAGGAGAAGTATGAACCGTTATGGATAAATGGAGGCGG
TCATTGCAATCTTGAACTTTACCCGGTTTACATCAAGCATCTAAAAAAGTTTGTTCTTGG
TCTTGGCAAATCAAAGACTGCTACAAATGGTTCTCATAAACCATCTTTAGTCTCTGACAC
TAAGAAGCCAGCTGAAAGTGTCTCCTCAAACACACTCAATCTGCATTCTGACCTTCCAGA
AATTTCAAGAAACAGTTTGGATAGTCGACTTGATAAGGCAAAGAAGTCGAACAAACCTGA
GAAGTCTCGGATGAGCACAGGTTGTGTTGACAGGTTTAGGAGACGGAAGGGATTGGTGTG
GTAATAATAGCTTTGTATAGGGGCAATCCTGTTAATTTATAAAACATTGGATTGAGACGA
GCTTAAATTGAGCGAAATGGACAGTGTGGATTTTTATAGCTGACTCCAACTTGCTGGGAT
TGAGGCGTTGTTCTTGGAACGTGACGCCCTAATGGGTGATTATAGGTGTAAATAATTGCA
TTATCTGTATCATTTAGAGGTGAAGTTGTGATTTCTGCATCCATTTTTGCCCTGTATATA
ATATCAAATGTTCAACTGTTATTTTTGATATAGGAAGCTTATAATTTTTGGCTGTGATCG
CGAGTTCTAATAAAAGTACATTGGCAAGAGAGACAAAAT