Microarray Probes on PGSC0003DMT400062463

Probe IDChipProbe Sequence
CUST_48482_PI426222305 JHI_St_60k_v1 GAGCTTCTTGATGAAGCAAGAGAAAAAACACAATCCGGAGAGAGAATGTCTAGAGAACAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062463

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062463 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G56290.1 +2 5e-71 219 106/141 (75%) unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:20878743-20879541 REVERSE LENGTH=173

Transcript Sequence (805 bp)

>PGSC0003DMT400062463 805 pgsc_dm_v3.4
CAGCTTCAAGGTAGTAATTAATTAAGTCTCAAATTCATACAATATAATGGGGCTGAGGGC
TATTCCCTTTTCACCTTCTCAAAATTACTATTTGAGTGGTTCAGAATATTTCCCCAAATG
CAGTATTCTTCGTAGCAGCAGAATTTGCTCATCAAAACTAGTAGCAATTTCAGCAAAGGC
TAAAAAAGAGGATACACAAGAAGAAGAACCAAAAAATAAGAGGAAACAATCTTTGTTTTC
AAGTGTAACTGAAGCTCTTGATTTTTCCCAAGTTAGATCTTCAAAGGACGCTGAGCTTCT
TGATGAAGCAAGAGAAAAAACACAATCCGGAGAGAGAATGTCTAGAGAACAGTATGGAGC
TCTGAGAAGGAAGATTGGTGGGACATACAAAGATTTCTTCAAGTCCTACGTTGAGGTGGA
TGGACAATATGTGGAGGAGGGATGGGTAGACAAAACGTGCAAGGTTTGCAAGAAAGATAC
GAGTGGAGAAGCAAGGCAAGTTGACAAATTGGGAAGATATGCGCACGTAGCTTGCCTAGA
AAAATCCCACTCTGGAAATTTCTTCACCAAGCTCTTCTCAAGATGAATTTTGTAGTATAT
ATCTTAAGGGCTAATTAGTAGTACGTACTATTTCCTCCTCTTATATATGAACTCATAAGA
ATATAACAGCCTTGGCCATTTTGTGTTTCTCTTTTTTTCTTGACTCAATCATGAATGTTA
TCAATTGGTCTTAGCCTCTTGAATAGAGTTATTCAAAAGTATATCAGTGTATTCAGAGGC
GGAGCTATGATTTTTTAACTTTATG