Microarray Probes on PGSC0003DMT400061952

Probe IDChipProbe Sequence
CUST_37028_PI426222305 JHI_St_60k_v1 GTTGCACAATAGCTGCTGTGACGCGATAATACGTTCACATTACTGGCTTGTTCTAACTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061952

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061952 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G43670.1 +2 7e-52 173 85/90 (94%) Inositol monophosphatase family protein | chr1:16468184-16470347 FORWARD LENGTH=341

Transcript Sequence (655 bp)

>PGSC0003DMT400061952 655 pgsc_dm_v3.4
TGGAATTGTTAACTTTGTATGGAATAGCTTTTGTTTTCATGGACATATTGTTAATCAACT
TAGTTGAATCTGGACTCTAATTTGCAGTATGGTTGCTGATGTTCATCGTACATTACTCTA
TGGAGGCATCTTCTTGTACCCCGGAGATAAGAAAAGCCCCAACGGGAAACTGAGGGTTCT
CTATGAAGTATTTCCCATGTCATTTCTGATGGAACAAGCAGGAGGCCAAGCATTTACTGG
GAAGCAACGGGCACTTGACTTAGTTCCAGAGAAGATACACGAACGCTCTCCTATATTTCT
TGGTAGTTATGATGACGTTGAGGAGATCAAAAAGCTCTACGCTGCTGAAGAGCAAAACTG
ATAGATGTATCTATACCATGTAATCACTTCACTACTCTTGCTGGTGCAGATATCAAATTT
CTCAAATTACAGCAAGTTGTTACTGTTTATGTTGCACAATAGCTGCTGTGACGCGATAAT
ACGTTCACATTACTGGCTTGTTCTAACTTTTTTTCTTGAAGTATCAATTTCTCATCAACA
ATAAAATGTTGAATAGAGAAGTTCTGGCTTATTATTGTTCATTTTAAATCAAATTTCTTT
TGTAATGTCATCCATTTAGAATCAAGCTAATTTTTTATGCTAGATGATTTCTGGT