Microarray Probes on PGSC0003DMT400061414

Probe IDChipProbe Sequence
CUST_41438_PI426222305 JHI_St_60k_v1 CACCAACCCACCTTCTGTAAACTGTGAATAGTTCAAGTTTTCAGTCTTTATCTTCAAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061414

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061414 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G51250.1 +2 1e-48 172 84/108 (78%) Senescence/dehydration-associated protein-related | chr3:19028227-19030442 FORWARD LENGTH=463

Transcript Sequence (1022 bp)

>PGSC0003DMT400061414 1022 pgsc_dm_v3.4
TAATGTGAATAGTCAATGTAATAGTTTTGACGTATTTGTTGGGGTGTGTTTTTTCAGTGT
TAAGAGAGTGACAAAAGTGACAGAGAAAATGGCAGTTGGGGTCCTATCTGGAGCTGTGAA
GGTTTCAGGATTCTTTACTAGGTCCCTTGCAAATTCCAAAGCAGGAAAAAAGTTCTTTAG
CCTCCTTCCAGGGGAAATGGTTCTTGCCACTCTTGATGGATTTAGCAGAATATGTGATGC
GGTTGAAGTAGCTGGAAAGAATGTGATGTCTACATCCGGCACTGTGACAACTGAATTTGT
TTCTCACAGATATGGAGAAGAAGCAGCTAAGGCAACCAGTGAAGGGATTCATGCTGTAGG
GCATGCTTTTGGGACTGTGTGGGCAATAAATGATGTGATTTCCCTTAAAGACTTCTTTAG
CTCCTCTGATTAGCTTAACAACTTTGAGCTTATCTCCTTGAAGCCTTTTGATACAACCTC
TTACTTCATCAAAAAGAAAAAGAAAGTCTCTGAACCCCAAAAGTGCCTTGAAGCCCACTG
CCCTGGCCAAATCTGCTGCTAAAGCTGCTTCTCCGGTCTCTGCAGCTGATAAGAAGGCTA
AGAATTTCAAGTCGTCACGTATAAGTGTGACCTTGTTTGACCTACCATTGCAGGTATCAA
TGCGCTATTCCTTTGTACTTGTAAAGCAGTATGTTGTCGTGAGAAGCTCAATTTAGCTGT
GTCTCTTATTAGCAAACTGATGTCAATGTGGGTGGTGGAGACAAGCAGCTCTTAGCAATG
ACCATTAGATATCACAAGAAAACACTCGAGATAACAGGCATTGGCTCTGACCTCTTCATA
CTATTTTTGTGTATGTGTGTGGTATATACTAGTGAGAGCACCAACCCACCTTCTGTAAAC
TGTGAATAGTTCAAGTTTTCAGTCTTTATCTTCAAATTTATTTTTATGTGATACCAACTA
GTTAAGATTAAGATTTGGTTATTTGTTATATTGAATTAAATTAAACACTGGACTTAGTGT
AT