Microarray Probes on PGSC0003DMT400060234

Probe IDChipProbe Sequence
CUST_14364_PI426222305 JHI_St_60k_v1 CACATGTCTCTCTAGGGTTTATTTTGTTTCTGTTGGTTCTTTCATTTGGTATTATTAGGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060234

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060234 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G12560.1 +2 3e-131 409 294/689 (43%) TRF-like 9 | chr3:3982272-3984848 REVERSE LENGTH=619

Transcript Sequence (2552 bp)

>PGSC0003DMT400060234 2552 pgsc_dm_v3.4
TTTTTTGGTGTAGATCGGTGAAATTAGTGACATTGGTTTATTGCATTGGGTGATCACTTG
TTGGCATGCTTCTGAAGATATGGTGTATAAGAAGAAGTTAGATTTTGGTTTCAATGGCTT
TCAAGTTCCAGTTATACCTAAAGCTCCTAGATCAGTTAGAAGGAGACGTTCCTGTAAAAA
ATTGGATGATGATCAAATTTGTGCATTTGAATTATTGGCGGCTGTTGCCGGGAAGCTTTT
ACTGGAGAGCGAAAGCTCTACTTCCAGTAATGCAGCAGAAGGGAAAAATGAAATTGCTGA
TGGCAGGGATGGTATTAAAAGTGAACAAGTGGAAGAAGGTAAAGCTGTGAAATCAGAGTA
CCTCGACCAGGGGAGTTGTGTAGAAAGCGATTATATACCCGAAACTGCAGCCCAAGATCA
GAATTTGAAACATGGTTTCGATAAGCCTCATCATGCAGAAAATAATTATTTCTTGGAGCA
TACTTCTATTGTTATAGGCTCTGACGCTGACTTGAAGTTGGAAAACTGCAAGGAGGTCAA
TATACCTGATGGAAAATTCCACCCCAAAATTGAAGGTGGATCCTCTAGTCTTGAAGATCC
ATGTGATGGTAAAATCAGGACAGGAATTCAAAAGCACTTAGATGATGACAGCAAGCAGAT
AGAGGACGTAACTGTGACTAACACTTGTAGTGTAAAGAATCCAATCGAAGAATGTGTTAA
TAACAGTGGTTTGTTTAACTCAGACGGTAGTGTACAGTTACCCTTGTACAGGGATTCGGT
TCCTAGTGCTTCTTTTGTAAAGCACAGGAACAGTGTAAAGTTAGGTATTAGAGATGATGA
CGAAAATTCTTTTGACTGCTATAGATATAGCACCAAGTTAAGGGCCTTTAGGACGACATC
ACGACTTGGATACAGAAGAATAAGGAAGATGCTGAAATCTCGACACTGGAAAGCAGCTCC
TAAGTTGAAGGAATATGAGCGATCTTACACAAATGGTGGAGTGGAGTCCTTTTACCTCAG
TAGGAAAAGTGTACGTGCACGCAAGAGATGCCAACTTGAAGTTCCTTCCAAGAGACGGAA
ATTGAGCAACCATGGCTTTGCTGTTGCATATTACCAGGAGGCCAGTAGTGAAAGCGTGAC
AAATTCACCTGACAAGGAAATCAAACGAGACATTAATACCTCCCATGCCATCCCACCGAG
AGGAACTACTGATCCAGCTCCAGTTAACAATCATCACAAAAAGGACCCTAATGTAAAATT
TAGCATCAAGTCCTTCAAGGTGCCAGAGCTTTACATAGAGGTTCCTGAAACTGCAACAGT
TGGCTCGCTGAAGAGAACGGTTATGGAGGCAGTTACCGCTATACTGGAAAGTGGATTACG
GGTTGGGGTGGTTCTCCAGGGAAAGAAGGTCAGAGATGACAATAGAACACTGGAGCAGGC
TGGCATTTCCCAGAACGGCAACCTCGATAATTTGGGTTTCACTTTGGAGCCTAGATTCAC
CCAAGTTTCTCCATCATCATCTCCTAATAAACTTCTGGCTTCATCAACATATGCTGCAGA
TCAGGAACTAACAAGGCGGCGACCTAGTCCTATATTGGAATTGGGGATTCACAACGCTTC
AGCAGACCCTCTAGAGACTGAGATGTGCAAGTACAACGAGAATAACCATCCATCAGAGCT
ATCTCCTACAAATCCTATTGATTCATCAACTGATGTATCTATTCCAGATTCTAGAGCCTT
GGTGATAGTTCCTTCAGTTAATGCAGAGGCACTTGCTATGGTTCCGCTGAACCAAAAAAG
TAAACGTTCTGAACTTTCACAACGTAGAATACGGAGACCATTCTCAGTTGCAGAAGTAGA
GGCACTAGTTGAAGCTGTGGAGCATCTTGGAACTGGAAGGTGGCGTGATGTTAAAATGCG
TGCTTTTGATAATGCTGATCACCGAACCTACGTCGACTTGAAGGATAAATGGAAGACATT
AGTACATACAGCAAGCATTGCCCCGCAACAACGAAGAGGCGAGCCTGTTCCCCAGGAACT
TCTGGACAGAGTCTTAGCTGCCCATGCCTACTGGTCTCAACAACAGGGGAAACATCATGC
TGAACCTCTGAAAACTCCAGATGCAAAAGCACTGAAAGTTGGCGCTTGAAGGAATTCGTC
GAATTGTCAATGATGTAAAGAAACTATTATATTAGGTAACACGAAGAGCACGACGAGGAA
ACTGTAAAAAAAGATTCGTTCTGTTTCTCGTCAACTCGGTTAGACTCACTGATTTGTTGC
CTTACAACAGTTGTGACTTTGTAAATTGCTCAGGAATAAAGCTGTGTAAGCAGCACATGT
CTCTCTAGGGTTTATTTTGTTTCTGTTGGTTCTTTCATTTGGTATTATTAGGGTTATGGA
AAGAATCAAATGTATTAAATATGTACATTAGTAGTAGTTCCAATTGATTTTCTAGTGTAA
TTTCACCATTGTAAGCAACTATCCTGATATTTAGTTGAATCTCATTTCAAGTGTTTTGTT
ATTAAGTATGTATCTATGTAAGATAATATTGC