Microarray Probes on PGSC0003DMT400059525

Probe IDChipProbe Sequence
CUST_9845_PI426222305 JHI_St_60k_v1 TATGTGATCCGTGTTTGCTCGCTCAAAAATGCTATATGTTATATGTTAAGTTGCACACAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059525

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400059525 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18210.1 +2 8e-11 59 26/67 (39%) Calcium-binding EF-hand family protein | chr1:6268273-6268785 REVERSE LENGTH=170

Transcript Sequence (685 bp)

>PGSC0003DMT400059525 685 pgsc_dm_v3.4
AAGGTATTATATGAAAAATTTACGACAGTCAAAGATATATTGTTTGAATTTAGAATTTAT
CCAAAATGTGTCACATAAGTCGGGACAGAGATTTGGTTGGTATTATATATAGGAAGTGAG
GGTTAGTTAATGTTAAGTCATCAAGAAGAAAAATATGCCTTGGTTAATTAATAAAGATGC
AAGCATAGCACTAACTAAGGATCAAGTGGAGAGAATTCTGAAGAGATATGACAAGAATGG
AGATGGAAAGTTAAGCAAGCAAGAGCTAAAAGTAGCTTTTAAGGAGATGGGCTTACGCTT
CTGTGGATGGAAAGTTGGGAGAGCCTTCCATCATGCAGACATGGACAGAGATGGATATAT
CAACAAAGAAGAGATGAGTGAACTAGTCAAATATGCTTCTAAATGGGGTATCAAGACTTA
TTAGTATAATATATATATATATATATTCTAATGTAAATAATTATATACTTCTTCTTCCTT
GGTTTCATCTTGCCTACTTCTTTTTTGGACTCAAGACCCTTGTAACTTTTGGAGGGAAAG
AGCTTAGTGTGTTTGATATATATATATATATATCTAAGTTTGAAATGGTATGTGATCCGT
GTTTGCTCGCTCAAAAATGCTATATGTTATATGTTAAGTTGCACACATATATATCTTCTT
TTTATTCTTTATGCTTTTATTTGTG