Microarray Probes on PGSC0003DMT400056565

Probe IDChipProbe Sequence
CUST_42849_PI426222305 JHI_St_60k_v1 TCTCGAGTGTTGTATCCTGAATCCGAAAGAGTGTACTTGAATTCTCCCCCTAACAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400056565

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400056565 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G20050.1 +2 3e-161 469 264/458 (58%) Protein kinase superfamily protein | chr5:6774381-6775739 FORWARD LENGTH=452

Transcript Sequence (1536 bp)

>PGSC0003DMT400056565 1536 pgsc_dm_v3.4
AAAAGTATGAAAATTTTATGATGATGAATTGATGGAGGACAAAAAAGTTTATTCCTTAGC
CCTTTTACTTGTGATTTTATTGATCACACTCATCGTTATCGCACGTATAACGTTGAAATA
TTCGGAGACATTTTTCCTCATTTTCGGAGCTGATGTTGCGTTGATAGTTGGTGTTTTTGC
TGGTGTTTTGATCCGAAGGAAGTTCAACAACAGGAGGTTATTGCTAGAAAATCAGTTAGA
CTCAGATGGACGCGAGCTGAGGATCGAGTATAGTTTCCTAAGGAAAGTAGCTGGTGTTCC
AACAAGATTTAAGCTGAAAGAGCTCGAAGAAGCAACCGATAACTTTGGATCGTTGGTAGG
ACGTGGATCATCAGCTTGTGTTTTCAAAGGTGTGCTTAGTGATGGTACATCAGTAGCTGT
TAAAAGGATAGATGGAGAGGAGCGTGGCGATAAGGAATTCAAATCAGAAGTTGCAGCTAT
TGCTAGTGTTCAACATGTTAATCTTGTACGTTTACTTGGATATTGTAGTGTTCCTCCTTC
AGGACCTCGATTTTTGGTTTATGAGTATATTGTTAATGGATCACTTGATAATTGGATTTT
TCGAAAAAGGGGAATTCGAGGGTGTTTGTCGTTGGATTTGAGGTGTAGAGTTGGTCTAGA
TGTGGCTAAGGCACTTTCTTATTTGCATCATGATTGTAGATCGTGTATTTTACATCTCGA
TGTCAAGCCTGAGAATATACTTTTAGACGAGAATCATCGTGCTATTCTAGCTGATTTCGG
GTTGTCTAAGTTGATGGGGAAAGATGAGAGTAGAGTTGTTACAACGATTAGAGGTACTCG
GGGGTATTTAGCCCCCGAGTGGCTCCTGGAGAACGGGATTTCTGAGAAAAGTGATGTTTA
TAGCTACGGAATGGTGCTATTGGAGATGATTGGAGGGAGGAGAAATATTACTTTAGCTGA
AAATGGGAAGAGTACCAATTCAAAGAGTAAGTTCAGCTATTTTCCTAAGATTGTGAGTGA
GAAATTGGAGCAGGGGAAGATCATGGAAGTCCTGGACGAGAGGCTCGTCCATGAGGCAGC
TACAGGAGGTGTAGCTGTAGAAATGCAAGTGAAAAGATTGGCGTGTGTGGCGTTGTCTTG
CATCCAAGAACGGCCTAGTCTTAGGCCAACAATGGCACGAGTCGTTGAAATGTTGGAAGG
TCGTGGGCCAGTAGAAGCGCCTAGACAAACGACAATGTTGATCCTTGATCTATTAGACGA
GGGTGTGGATCATCATCCTGGGATACCTAGGGTTGCTGCAGCCATGGCAAGATCTAGTGA
TACTAATTCGCTTCGCTCTTATACAATGTCTATTCTCTCAGGGAGGTAGTACCTACATAA
TGCATAAGGGATTTCGTCTGCTTTCTGTCAAATTTTTCAATATCAATAGGTTGATTGTTT
CTCGAGTGTTGTATCCTGAATCCGAAAGAGTGTACTTGAATTCTCCCCCTAACAAAAAAA
AGTGTATGAATTTGCTTTTGTTTACGCCAAAATATA