Microarray Probes on PGSC0003DMT400054998

Probe IDChipProbe Sequence
CUST_18373_PI426222305 JHI_St_60k_v1 GTCTGCTTCAATCTACAACAAGTTCGGGTCGACTATATGAATCCTCACTATATTTTCTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054998

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054998 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G06530.2 +1 3e-74 184 86/103 (83%) ABC-2 type transporter family protein | chr5:1990060-1994605 REVERSE LENGTH=751

Transcript Sequence (1943 bp)

>PGSC0003DMT400054998 1943 pgsc_dm_v3.4
TGTGAAATCTTTGGCAGGATTGGATTTGTGACTCAAGATGACATACTATTTCCTCACTTG
ACAGTGAGAGAAACTTTAACGTATGCAGCACGCCTACGACTACCAAAGAAACTGACGAAG
GAGGAGAAACAAAAACGAGCCATCGATGTGATATACGAGCTAGGACTAGAGAGGTAAGTT
ATTGTTTCTATACTTGACAAATTTGTGAAATAATCTTCGTGTGACCAGAGGCAGAATGAT
AAATTTTGAGTTTATGACTTCTGAATTCTAAGAAAAAGGTAGATTACTGGATTCAGGATA
AGTTATTTATACATATTAAGTAAATTTCCTATCATGCATTTCATTTTGTGAAAGCTGAAT
GAGGAATGTGATGTTTTATCAGATGCCAAGACACAATGATTGGTGGCTCCTTCGTTCGTG
GAGTATCAGGAGGAGAAAGAAAACGCGTCTGTATTGGAAATGAGATCATAATCAACCCCT
CCTTATTGTTCCTCGATGAACCTACATCCGGTTTGGATTCAACAACAGCTTTAAGGACAG
TTGAGATATTACACGATATCGCTGAGGTAAGACTTTCTCTCTGTTTTATCTAAGATTTCG
TCATGGCACGAGTCATATGTCCTTACAATTCTGTGGTTATAGGCTGGAAAGACAGTGATC
ACAACGATCCATCAACCGTCTAGTAGACTATTCCACAAGTTTGATAAGTTGATTCTTCTT
GGCAAAGGGAGTTTGCTTTATTTTGGGAAGGCATCTGAGGCAATGGACTATTTTTCAACT
ATAGGATGTACACCTTTGATACCAATGAATCCAGCAGAATTCCTGCTGGATCTCGCGAAT
GGAAACTTAAACGATGTTTCCGTTCCATCAGAGTTGGAGGACAAAGTACAGATTGGGAAT
TCAGATACTGAAACAAGGAATGGAAAGCCATCACCAGCAATTGTGCATGAGGTGAATAAA
TTCTACTACTCTCTCCGTTTTAATTTGTTTATCTTACTTTCCGTTTCAAAAAGAATGTAT
ATATGTCTCTTTCCATTTTTTTGGCAACTCTTTAATTCTAACTTTCCACACGTCATGTTT
AAGACTACAACATGAAAGGACATTTTGGTACATTCGACGAGTGCGTGTCGGATCCTCCAA
AAGTAGTGCATTTTGGATGATCAGATACGAGTGAAGCATCATTTTTGAAGAATCCGAGCA
ACATACTTTTTTCATTCTCAAGGACATAAGTTCTTTGATCATTTCTGAGAAAAAAACTCA
ACCTATCACTTAGCATACATTTAAAAAAAAATTCTGCTCCTTTTCAACTTTCTGAGTTTT
TCGGCCTTATTTGCTCGAACTCTTCAAAAATGTTGGATGGATGCATGTCGTATCCTTGAA
AAATAGTGTATTGTTGGAGGATCCGACACAAGTGCAACAACATTTTTGGAGAGTCGTTTA
CATATAAAAATGCAGTCAAGCAGATAGATCACCTCTATGTCTTGGAACACTTACACAACT
AGTCATAGAAAGAGCTCAACTATTTTCCAAAACAATATATCAACAACAAGTCTGCTTCAA
TCTACAACAAGTTCGGGTCGACTATATGAATCCTCACTATATTTTCTTTTTGATTTTTAA
CAGTATCTAGTGGAAGCATACGAAACGCGAGTTGCTGAGAGCGAAAAAAAGAAACTTATG
GCTCCCATGATGATTGATGAGGAATTGAAGTCTAAAGTAGTTACCTCAAAGAGAGAATGG
GGAGCAAGCTGGTGGACACAATACTCCATATTGTTCTGGAGAGGACTTAAAGAACGACGC
CACGATTATTTTAGCTGGTTGAGAATCACTCAAGTTGTTGCAACTGCAGTTATCTTAGGC
ATGCTCTGGTGGCAATCTGGTGGTGGTAGTCCTAAACATATGCAAGAACAGGTATTTGAC
ATATATACATAGTATAATTTTCC