Microarray Probes on PGSC0003DMT400052944

Probe IDChipProbe Sequence
CUST_11413_PI426222305 JHI_St_60k_v1 CACTCAACATCTTGATGTCTGATCTGTTTTGGGGTTTGATGAATTCTTAATGGGAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052944

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052944 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G51780.1 +3 1e-55 186 111/261 (43%) BCL-2-associated athanogene 4 | chr3:19207029-19208178 REVERSE LENGTH=269

Transcript Sequence (1087 bp)

>PGSC0003DMT400052944 1087 pgsc_dm_v3.4
CAATTTCTCACCTTTTTAATATTTTCTCATTTTACTTTTTTTTTTGTGGAAAAAACATGA
GAAAAAAATCATCAACTTCTTCAAAAAGTAAGAATGAGATAATAAAAGATGAGAATTATA
AATTCACTGAGTTTGAAGAGGAAAAAAAGAGTTGTATTATTGATTGGGAAGTTAGGCCTG
GAGGTTTATTAGTTCAGAAAAGAGTTGGAATTTCTGCTGAGGAAAATTATGTTGCTGGCC
CTATGATCAAGATCAAAGTCTCTTATGATTCTTGTTACCATGATGTTGTTGTTCCTGCTG
AATCAACATTTGGGAACTTGAAGAAAATTCTTTGTGACACAACTGGCTTACATCCTAATG
TCCAGAGATTATTGTTCCAAGGAAAAGAAAAGGATGAGAATGAATGCTTACACATTTCTG
GTGTAAAAGACATGTCAAAGGTGATCCTAATGGAAGATCCAGCCAGCAAAGAGTTGAAGA
AAATTCAGGATACCTCTATCTCTTCTGAAGCCATCGCCCGAGTAAGAGTAGAGGTCGATA
AGCTCTCACATAGGGTTGTGGCCATAGAGGAAGCTGTGCAAAGAGGTACCAAAGTTGAGG
ACAGAGAATTTGTTGTCCTAACAGAGTTGTTCATGATTCAACTTCTTACACTTGATAGCA
TTGAAGCAGAAGGAGAAGCAAAAACTCAAAGGAGAAAGGAGGTTCATCGCATTCAGAGTT
TTGTTGATATGATTGACAATTTTAAAGCAAGAAGCTCTAGCATTGCTAGGAATTGTATTG
GTACTATTTCAATGGTGAATACCAAATGGGAAATGTTTGATTCAGGAATTGGAAGCCTCA
ATGCACCAAATCAATCCACAAAAATCACACAGGAGTGGGAAATTTTTGACTGATTGATTT
TGAGTTATGAGTTTCTTGTGTTGTTAGTGATAATATCAACTATGTATTGTTCTTTTAAAA
TCATTCTCATTGCTTGTGTAGAATTTTTTGGAGCACTTGTATGGTTAAGAAATGCACTCA
ACATCTTGATGTCTGATCTGTTTTGGGGTTTGATGAATTCTTAATGGGAAAAAAAGTTAA
TGAAGGA