Microarray Probes on PGSC0003DMT400052637

Probe IDChipProbe Sequence
CUST_18965_PI426222305 JHI_St_60k_v1 TGATTCTTGTTTTTCCGGTGATGAAGCGGCGGAAGTTAGCATGCCATCACCAAGAAAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052637

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052637 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29280.1 +1 2e-62 200 118/249 (47%) WRKY DNA-binding protein 65 | chr1:10236589-10237467 FORWARD LENGTH=259

Transcript Sequence (771 bp)

>PGSC0003DMT400052637 771 pgsc_dm_v3.4
ATGGAAGATAGTCTATACAAAAATCCATTTTTTCATAAACAAGAAGATTCCACCGGAACT
CCACCGGATAATGCTGCTGATTCTTGTTTTTCCGGTGATGAAGCGGCGGAAGTTAGCATG
CCATCACCAAGAAAAAGTAGGAGAGGAGCAAAAAAGAAAGTAATTTCAGTGCCAATAATT
GAAGGTGATGGATCAAGAAGTAAAGGGGAAGTTTATCCACCACAAGATTCTTGGTCTTGG
AGAAAATATGGACAAAAACCAATTAAAGGATCACCTTATCCCAGGGGATATTATCGATGC
AGTAGCTCCAAAGGCTGTCCCGCCAGAAAACAAGTCGAGCGTAGCCGCCTGGACCCCACC
ATGCTTCTCATTACCTATTGCTCCGAACACAACCACCAAATCCCGGCCGCCGCCGCCGCC
AAACACCACCACACCAACCACCCTACTACCACCACCACCACGGACTCTACCGTACTAGAC
AAATCATCTCCGGAAGAACCAGATCTATTTGCTTATCAACACGATAATGGATTTTCAGAG
CTCGCCGGTGAGTTAGGTTGGTTTTCCGATATGGGAACAACTACTACATTGATGGAGAGC
ACGTCGTCGTCAATGGTGGGATCCACGTGGAACGATAGTGACGTGGCGTTAATGTTGCCG
ATTCGGGAGGAGGATCAGTCGTTGTTCGGTGATCTCGGTGAATTGCCGGAATGTTCAGTC
GTTTTCCGGCGGTACAGTGTGGAAACTCCCTGCTGCGGCGGTACAGGATAA