Microarray Probes on PGSC0003DMT400051809

Probe IDChipProbe Sequence
CUST_25800_PI426222305 JHI_St_60k_v1 GTTAAATGTCATTTCTGTCCTGCTCTTGCTAAGGCTGTGAAAACTATGAAGAAAGGTGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051809

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051809 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G25230.2 +1 0.0 836 455/551 (83%) rotamase FKBP 1 | chr3:9188257-9191175 FORWARD LENGTH=562

Transcript Sequence (2241 bp)

>PGSC0003DMT400051809 2241 pgsc_dm_v3.4
GGAAGAATCCTGACCCTTCGTCGCGCTAAAGCTCTCTCAAAAACCTTGGAACACTCTAGA
ACCTAAACCCTTTCTTTTCACACTATCTATCACACCATTTAAGCCTCCATCTTCTTCATC
TCCAGCACGCCATTATTTACTTTCACTGAGCTCGATTCTATCAATCAATCAATCTTCTGC
GTGTGAGTGCATATTGTGTTTGACGGGAAAATGGACGAGGATTTTGGTATTCCACCGGTA
GAGGGAATGAACGAGGACATGGATCTGCCGGATGACAGTTCGACCCTGAAAGTAGGCGAG
GAGAAGGAAATTGGAAATCAGGGATTGAAGAAGAAGCTTGTTAAGGAAGGTGAAGGTTGG
GATACTCCTGCGCCTGGTGATGAAGTCGAAGTTCATTATACTGGAACTTTGCTTGACGGA
ACCAAGTTCGATTCCAGTCGCGATAGAGGGGACCCCTTCAAGTTTACTCTCGGTCAAGGA
CAAGTTATTAAAGGATGGGATCAAGGTATAAATACAATGAAGAAAGGTGAAAATGCTATT
TTCACCATTCCTCCAGAGCTTGCTTATGGAGAGAGTGGTTCTCCTCCAACTATCCCTCCA
AATGCCACTCTACAATTTGATGTTGAGTTGCTATCATGGGTGAGTGTAAAAGACATTTGC
AAGGATGGTGGAATTTTCAAAAAGATCCTCACAGAGGGGGAGAAATGGGAAAACCCGAAA
GATCTTGACGAAGTATTTGTCAAGTACGAAGCTCAGCTCGAAAATGGCACAGTGGTGGGA
AAATCAGATGGAGTGGAGTTCACTGTTCAAGATGGTCATTTCTGTCCTGCTCTTGCTAAG
GCTGTGAAAACTATGAAGAAAGGTGAAAAGGTCCAATTGACAGTTAAGCCGCAATATGGC
TTTGGAGAGAAAGGAAAACCAGCCTCAAGTGATGGAGGAGCAGTTCCACCTAATGCCACA
TTACAGATCAACTTGGAGTTGGTCTCGTGGAAAACTGTTTCAAATGTTACTGATGACAAG
AAAGTATTAAAGAAGATCTTGAAAGAAGGGGAAGGATATGAGAGACCCAATGAAGGAGCT
GTTGTTAAATTAAAACTGGTTGGCAAGCTGCTGGATGGCACAGTCTTCACAAAGAAGGGC
CATGATGGGGAAAATGAAGACAACCTTTTTGAGTTTAAGACAGATGAGGAACAAGTAATA
GATGGGCTAGACAGAGCTGTCATGACAATGAAGAAGGGTGAAGCGGCGCTGCTTACAATT
GCACCTGAATATGCCTTTGGTTCATCTGAGTCAAAGCAAGATTTAGCTGTTGTTCCTCCT
AATTCAACTGTGCATTATGAGGTTGAGCTTGTTTCTTTTGTCAAGGACAAGGAATCATGG
GATATGAATACCCCGGAGAAAATTGAGGCTGCTGGCAAAAAGAAAGAAGAAGGGAATGCA
CTGTTCAAGGCTGGTAAATACGCAAGGGCATCTAAGAGATATGAGAAGGCTGCTAAATTC
ATCGAGTATGATACTTCCTTCAGCGAGGAGGAAAAGAAACAGTCTAAAGCATTGAAGATC
ACCTGCAACTTAAATAATGCAGCTTGCAAGCTGAAATTGAAAGATTACAAGCAGGCCGAG
AAACTGTGTACCAAGGTGTTGGAACTGGATAGCGCAAATGTCAAAGCTCTTTACCGCAGA
GCTCAAGCATATATGAACATGGCTGATCTTGATCTGGCTGAATTTGACATTAAGAAAGCT
CTTGAGATTGACCCTGACAACAGGGATGTGAAGCTTGAGTACAAAGCTCTAAAGGAAAAA
GTCAAGGAAATTAACAAGAAGGATGCAAAGTTCTATGGAAACATGTTTGCAAAGTTGAAT
AAGCAGGATGCAGCAAACTCAGCCAACTCTGCTGCCAAGGAACCAGAACCGATGAGCATT
GATAGCAAGGCATAACTTTTAACTCAGACATGACATAAAAAGGATCAGCATCATTTTCTT
GACGGTTTCGATGAGATGTCATAAATGCCATGGAGTCGTTATAGTTGGATTTTAGGAAAA
AGTGTTTGCTGAATAACCTGACTGTAATTTCTGATTTTGCATTGGGTACTTATATTGATG
GATCCTCCTGTAATAGAATTTCGTCTGGCATCATTGGTGTTCCAATCTTTTACTAGTTAT
TATGTGTTGTCCTTTTGTTGAGAGGAATTAATAAAAGGTCATTTGAATTGCTGTAGAAAA
ATAATCAGTTCTTGAATTGCA