Microarray Probes on PGSC0003DMT400051643

Probe IDChipProbe Sequence
CUST_25814_PI426222305 JHI_St_60k_v1 GACAGAAACAATCAAAGTAATGCAGACCTACAGCTTGCAATTACTTTTCGATATCAAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051643

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051643 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G28060.1 -1 1e-10 59 26/31 (84%) Ribosomal protein S24e family protein | chr5:10069791-10070792 REVERSE LENGTH=133

Transcript Sequence (974 bp)

>PGSC0003DMT400051643 974 pgsc_dm_v3.4
GCTAGTCAAGAAGATATTTTTTTTCAAATAAGTTAGTAACGTAATCATAATCCTTGTAGC
AACACTTGAAATGGTGATTATAAAATAAAGAACATGTTGAGAAAAACGCTACACTCACAA
ATTCACTAAGTGTAGAAGTACTAGCACATAAACATGCAAATATAATTTGAGTGACAACCA
AAATTGAAAAGATTCTGCATAAATGTCCAGAGAAACATAAATAATATGGAAAACGTTTTC
AGCATTTGGCTTAAAGGAACTATCACTGGCAGATCATTTCTTCTTGGCATCTCCTGCCTT
AGTCTGCAAGAATCAAGCAACCAGTATCAGCACAAGAATAAAATAAAACGATCCAAAATC
AAAAGAACCTCTCTCAATGTTGTAGCTGTAAAGGCAAAAATAAAAACCATTACCTTCTTG
ACACCGCGTACTTTCTTGGCTCTATTCTTCCGCTCCTTCATCTGCTTCCTAGATTTCTCA
ACCTTTGTGTCTAATCCATTCTGCAAGTGTTGTTCAATAGCAAGACATATTATTTTAGCC
ACAAAACAAAAATTACAGCCAAATTCAATCATTAAGCCCACACATTGAACACTGAAGACA
GTGAAGATGCATTCAACATAATGGAGCAACAAACTCAAGCAAATACTTTACTTAAAGATG
AGTGCTTGAATTAGCACAGATAGAATACTAAAAACAGATCACTAGACAAACATACAAAAG
AGAAAGCAACAGCAACAAATGCAACACAAAACCAGAATCAACTGAATGAGCAAGGGAAGG
ACAGGAGGAAGAGATCAGGTATAGAACCACACGTATTTATGGTCTAATAGCCTTCAACAC
AACATAACTCAAACTAATAGTCTTTTAGACAGAAACAATCAAAGTAATGCAGACCTACAG
CTTGCAATTACTTTTCGATATCAAAAGAACAAAAGGATAATATTAGTGTAGTTGTGTAAG
ACACTCAACTTCTG