Microarray Probes on PGSC0003DMT400051428

Probe IDChipProbe Sequence
CUST_18984_PI426222305 JHI_St_60k_v1 TGTAGTTTCAGCTGAGGAAAGTGCAGCAGAGTATGCAGCTAGGAAAAAAGCAGAAGCAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051428

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051428 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G53040.1 +1 7e-21 96 87/265 (33%) late embryogenesis abundant protein, putative / LEA protein, putative | chr3:19664797-19666405 REVERSE LENGTH=479

Transcript Sequence (1803 bp)

>PGSC0003DMT400051428 1803 pgsc_dm_v3.4
GATAGAGTTAATAAAATGGCTAGTCATTTTGAGTCTCTAGCTGATAAAGTTCATGAGGAT
ACAGAAACTTCTCCTGATGTTGTTCATGTCAAGACTACTGTTACTAGTAGTGTTCCTTAT
CAAGAACATCAAACAGAGAAGCAACGATCATCTGATATAATGGATAAAACTCAAGAGAGG
AAGCAACAAGTATTTCAAGAGAAACCAGGCGGTGTTAAATTTGGAGTTCAGGGCCAAGAA
CACGAAGATTCCGACATAAACAGAGGAAAACAGAGCAAAGGTGGTGCTGAAGAGACGAAA
GGTGGTCCATCATTGGAGGAAATTTCTCAGTACAGAGCAACAGCACAGGAGAATTCGATG
AACGCGATAAGGGCTGCTGAAGAGCGGTATGAAAAGGCAAAGGAAATGGGTGGTTCTACA
TTGCAGAATGTTAAAGAATCTGCAACTCATGGACTTGGTGCTACGGGTACTTATGCAGCA
GAAAAGGGTGCACAAGCTAAAGACACCATTACTCAAGGCCTGCAAAAGGGAACTCAATAT
GTTGCTGAAAAAGCTGGAGCTGCTAAAGACGTCGCCCTCGAAAAAGGCCAACAAGCTTAT
GCTGCAACTAAGGATACCCTTTCGGGTGCCGGACAAACTGCAGCTCAATCAGCTCAACAA
GCTAAAGATTACACTATGGAAAAAACAGGGGATACCAAAGATTACACAATGCAAAAAACA
GGGGAAGCTAAAGATTTTGTAGCCCAAAAAAGAGGGGATACAAAAGACTACACTTCACAA
AGAACAGGGGAGGCCAAAGATTATGTTGCTCAAAAAACAGGGGAAATTCAAGAACAGAGC
AAAGGTGCAGCAAGTTATGTAGGAGAAAAGGCAGCACAAGTTAAAGATGTTACATTAGAA
ACAGGGAAAGGCGCGGTAGGATACGCAGGGAAAGTAGCAGAAACAGTGAAGGACAAAGCG
GTTGTAGCTGGATGGGGAGCTGCACATTTCACTGCTGAAAAAGCTGCAGATGCAACTAAA
GCTATAGCTGGTGTTACTTCTACTGTTGCAGGGTATGCCGGAGGAACGACGGTGGCCGCG
AAGGATTTGGTTGTTGATGCTGGAAAGAAAACAGTGGGATTTGCAGAGGATACGTTGGCT
GCTGCGAAGGATTATGTAGTTTCAGCTGAGGAAAGTGCAGCAGAGTATGCAGCTAGGAAA
AAAGCAGAAGCAGAGAGAGAATTAGAAGCTAAGAAATTACAAGAAGACACCAAGGGAGAA
AACAGAAGAGGGTTTATTCCAGGAGAAAAGGTTGAAAGAAGAAAGGAGAAAACAGAAGAA
TCCTACTTCGAGGAAGAAGAGGAGTCGGGAGTCGGAAAAGAAAGCAAGCCGGTGGAAGGT
GCAGCGGTGGTGTTGCAAGCCATTGGCGAAACTATAGTTGAGATTGGGAAAACAACTACT
GAACTTGTTGCAGGTCGCGGTGGAGATGAACCAGTTGTGGGAATTGAGAAAGAGTCTACT
ACCACAATCAAGAAAACTTGAGATGACATATATCGTTTCGTTTTGATTTGGTTTTCGATT
GGTTTTGTTTTTCTGGACTATTGAATAATAATTAGCATAAATCGCGTAGACTTGTGTACT
ATGTATGTTCTCATGTTAATAGTAGTGTTGTTCTCTTGTCACATTTAGCCTTATTATAAG
GCGACTCTACGATGTATCGTTTCTCCTTATGAACAACAATTACCAAGCATTGGGAGTTGA
TAATTGTTTACAATGGGGATACAAATATGTTGTTCTTAATGGGATATTGATGGTTGTCCA
CAA