Microarray Probes on PGSC0003DMT400051388

Probe IDChipProbe Sequence
CUST_49472_PI426222305 JHI_St_60k_v1 CATATTAATAATCAGTCTGCGCTTGCACCAGATTCTAACTCTTCAAACTCATCAATTATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051388

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051388 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G24030.1 +3 0.0 600 295/448 (66%) SLAC1 homologue 3 | chr5:8118618-8120993 REVERSE LENGTH=635

Transcript Sequence (2235 bp)

>PGSC0003DMT400051388 2235 pgsc_dm_v3.4
CTTTTTAGTAGTGTGAATAATTAATGATATTGGTCTAACAGGAGTATTAAATAAGGATGG
GAACAAGTGATCAACAAATTCATCCTGCAAACGAAGCTTCTCCAGAAGGACTTCCATCAC
TTATCAGATTCATCAGTTATGAAATGGACCATGATTTTGATGCCATAGTGAATGACCATA
TTAATAATCAGTCTGCGCTTGCACCAGATTCTAACTCTTCAAACTCATCAATTATGATAT
CTGAAGCTGCTGCTGCTGCTGCTGAGCGAGAGAGCGAAAGAGTTCATGCAGTTTCCATTA
GCATGCCACCCACTCCGAAAAAAGTTGGTTTCGCTGAGAACCACAAGACTATAGATGCTC
CTGATTCTGCTGCTGCTACATCAAAAGATAGGAAAACAAAGTTTTATTCTCAGCCTATGC
CAAGAGCTAATACTACTACTGCATCTTCAGCTGGAGCTCATGCGAGCTGCGAACTTCCTA
GGCATCCTAGGATTAGCAAGTCGAAGGATAAAAGATTTGACAGCTTCAAAACATGGTCTG
GTGGGCTTGAGAGACAATTATCAAATTTGCGCGGAATTAGGAACCAGGAAACAGAACAAG
AGTCTGTAGCTCAACCCTGTGCTGAACCGGAGCCTAATACTCCGGTTAATATTCCTGTGG
ATCGATTTTTTGATGCCTTGGAGGGACCAGAACTTGATAAGCTAAGGGCTTCTGAGGAAA
GTATCCTTCCAGAGGACAAGACATGGCCATTTCTACTCCGTTATCCTATTTCATCGTTTG
GTATCATTCTTGGCGTTAGCAGCCAAGCTATAATGTGGAAAGCCTTGGCCACTTCTGCCT
CCACCAAATTCCTCCACATAAGCATGGATGTAAACCTTGTGCTTTGGTGGATCTCTGTTG
TCCTGATGGTGATTGTTACTTTTGCTTATGCGTTGAAAATCATTTTCTACTTTGAAGCAG
TTCGTAGGGAGTACTACCACCCGATACGTGTTAACTTCTTCTTTGCTCCATGGATAGCAC
TTCTATTCTTAGCACTTGGACTTCCACCTTCAGTCTATCAAAACCTTCCTCATGCTTTAT
GGTATGTCCTTATGACTCCATTCTTATGTTTGGAGCTCAAGATTTACGGACAATGGATGT
CTGGTGGTCAACGAAGGCTCTCAAAGGTAGCCAATCCATCGAATCATCTCTCAGTTGTGG
GAAATTTTGTTGGTTCCTTGCTTGGTGCATCCATGGGACTAAAAGAAGGGCCAATTTTCT
TCTTGGCTGTTGGATTGGCTCATTACACTGTTCTTTTTGTAACTCTCTACCAAAGACTTC
CAACAAATGAGACACTTCCAAAGGAGCTACATCCTGTGTTCTTTCTATTTGTTGCTGCCC
CTAGTGTTGCTTCTATGGCATGGGCAAATATCCAAGGGTCCTTTGATTTTGGTGCACGGA
TCGCGTACTTCATTGCCTTGTTCCTTTACTTCTCACTGGCTGTTCGGATTAATTTCTTCC
GAGGCTTCAGGTTCTCATTGGCTTGGTGGGCTTACACTTTTCCAATGACCGGAGCTGCTA
TTGCCACGATCAAATACTCAATCATGGTTAACACGGTTGTGACAAAGTGCCTGGTTGTCA
TACTTTGCACCCTTTCTACATTCACAGTGATGGGACTGCTTGTGACAACCATCATTCATG
CCTTTGTTCAAAGAGACCTCTTTCCAAATGACATTTCTATTGCAATTAGTGAAAGAAAGC
CTAAAACCCATAGACGATGGTATCATCATAGACGAGCTGGCAGCACAGATATTGATCAAT
TCCTTAAGTATGCTGATTCTGCTGAAGCCAAAGATATCGAAGCAGCTCTCTCTGGCAGTG
TAGAGTTAATAAGCACCTCTGCTCCAAAAGAAGTTAGTCAAGATTGAGTCGTTCTGTTTG
AGGATCCTGCATTAAAATAGCTTGCATCGCTTGTAAAGCCTTAAGCTTTTAATCAAGTGA
GGAACACCAAGAGTTTGGTGATCCTGTGAACTTGATATAGGAGAAGGCACATAAAAGGTC
TTGTAAAAAGAAGGATGCAAGAGAAGGACGAGTGTCGTTCCAAGTTTAAAGTTTTCCTTT
TTGTATAAAATGTTTGAGATGAGTATCTATAAGGAGGACGAGTGTTGTTCCAAGTTTAAA
GTTTTCCTTTTTGTATAAAGTGTTTGAGATGAGTATCTATAATAAAAGGGTCCTTGGTAT
CTTTTTTCACCTCTG