Microarray Probes on PGSC0003DMT400051047

Probe IDChipProbe Sequence
CUST_6530_PI426222305 JHI_St_60k_v1 GAAACTGAATTTTTGGTTCATTGAAGGAGGGAGAATTTACTTGACCCGTATTTTAGTAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051047

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051047 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G80840.1 +3 2e-76 249 161/344 (47%) WRKY DNA-binding protein 40 | chr1:30383834-30385356 FORWARD LENGTH=302

Transcript Sequence (1956 bp)

>PGSC0003DMT400051047 1956 pgsc_dm_v3.4
TCCAAACTTCAAACCCCCCAATTACATACCTTCCTATTCTCTCTTACAAATTTCAATCAA
AATTAAAGCAAATGGAATTCACCAGTTTAGTTGATACTTCTTTGGATTTGAACTTTAGAC
CTCTTCGAGTTTCCGATGAATTACCGAAACAGGAAGTTGAGAGTAATTTCATTGGACTTG
GAAGAGATCCTGTACTACCTATCAAAGATGAGACAGGTAATTTAATGGAGGAACTAAATA
GAGTAAATGCTGAAAATAAGAAATTGACGGAGATGCTTACAGTTATGTGCCAGAATTACA
ATTCATTGAGGAGTCAATTGACGGAATATTTGAGCAAGCAGAATAGTAGTACTAGTGGAG
CTGATCAGGATCAGAACAGCGATGGATCGAAGAAAAGAAAAGTTGAAAACAATAATAATG
AAATTGTGAAATCGTCAGTTCAACTGTTGAATTCAGATAGCAGTTCAAGTGATGAAGATT
CATCTCCAAATAAACCAAGAGAAGAACACATTAAAACTAAGACTTCTAGAGTTTATATGA
GAACTGAACCATCTGATACTTCTCTTATAGTGAAAGATGGATATCAGTGGAGGAAATATG
GTCAGAAAGTAACAAGAGACAACCCATCTCCAAGAGCTTATTTCAAGTGCTCTTTTGCTC
CTACCTGCCCCGTTAAAAAAAAGCTTCAAAGAAGCGTGGAAGACCAATCGATTCTAGTAG
CAACATATGAAGGAGAACACAACCATTCTAAAGTGGATACTGTTACAACAACTTCCCCTT
CTAGCCGTTTCAACCCGAAAAACAATGTTTCGGGTAATTATACTGCTTCAGTAATGCCAA
GTTCCACTACTAATATATCAAGACCAAAACCAATGTTAACTCTTGATTTGGCTGAACCAA
AAACATCACAAAATGATGTCAAAAAAGTGAACAGCAATACAAGTAGTGCAAGTGGTCACA
AGCGTAAATCACCAGGAAATGATCATCAACAACACCAAAATAGACCAGAGTTTCAACATT
TCTTGATAGAACAAATGGCTTCATCATTGACTAAAGATCCAAGTTTTCAAGCAGCCTTAG
CCGCCGCCATATCGGGAAAATTCTTGCAAAATAATAATAATAACACTATTGATAAATGAA
TGAATAATTAAAACGAAAATTATGTCTCACATTGAAATGTTGCAGAGAAAGACAGGTCGC
CACTAGGACATGTTGTATATAGTGTTTACTATTTTTATTGGAGAACAGTAGGCAGTAGGT
TGGACTAGTAAGTGCACGTGGAAATGGAATGTGCTAATTTTCTATAGCAGCCTATATTAG
TTAGGTCTCAATTTGCGCCTTTCAGTCTCACAAGATTGAGACTTTTGGTGGTCCTAAATT
AAATTGTTGAATTTGCTCAAATAAATATTTAATAATTTGATTTCTCCTCCTTACTTTTGT
GTAGACTATGGCATCTCTAACTTGTTATATTCTTTTGGGCGTTACTGAAAAGAAAAGAAA
AAACAGGAGATACATCATACATAAAAGGGGTAAGAATATTCTTAATTGTGCGAGTATTTT
AGGAAAAACTGTACAGATTCAATCCAAAGTGGATAATATCATAATATCTTTGAACTATTT
TAGCATGACAAGCTCATTTGCTACTTGTTTTTTTAAATTGGTTTCTATTCTATTCGACTA
AGGTCAAGAAATGGAGGCCAAGTTGAAGTCAAAAGAAGAAAAGACCACACGTGAAACTGA
ATTTTTGGTTCATTGAAGGAGGGAGAATTTACTTGACCCGTATTTTAGTAGAAAAAAATT
CTTGATCTAGGGATTAAAATAAGGGAATTCAGGGGCATTTTGAGACTATAAATTGAAATA
GATATTGGTTTCTAAATGTTAACATCAGCCACTTGATGTCATTGCTTCAATATTTATATC
CTATTTAAAAGACGAGATGTAATTTTTTGGTGGAAT