Microarray Probes on PGSC0003DMT400047948

Probe IDChipProbe Sequence
CUST_45899_PI426222305 JHI_St_60k_v1 AATTGTCAGTGTTGATGTTGCTCAGGTTGGATCGTCGAACTGGAACTTCTTGACCCGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047948

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400047948 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G45970.1 +1 4e-118 346 165/245 (67%) expansin-like A1 | chr3:16896238-16897189 FORWARD LENGTH=265

Transcript Sequence (1043 bp)

>PGSC0003DMT400047948 1043 pgsc_dm_v3.4
CATTTACTCACTCAAAACAATTCATTCTTCAAATCAAATCCTTTAAACAAAAAAATGTCT
CTCTTCTTCCTTGTCTTCCTTCTTTTTGTCTCTTCTGTTATAGCCTGCGATCGCTGTGTT
CACCAATCCAAAGTTGCTTATTTTTCCAGTGCTTCTGCTCTTCTCTCGGGTGCGTGTGGT
TATGGAAATTTAGCAATAGGCTTCAATGGAGGTCGACTTGCCGCTGCTGTTCCTAAACTT
TACAATAATGGTGCTGGATGTGGTGCTTGTTATCAGATAAGATGTAAGGACCCAAAAATT
TGTTCAAAACATGGAACAACTGTAATGGTTACTGATCTAAATACGAATAACCAGACTGAT
TTTGTGATCAGTAGCAGAGCTTTTATGGCTATGGCCATTGAGGGAAAAGCTAAAGACGTT
CTCAAATTGGGAATCGCCGATGTTGAATACAAAAGAGTTCCTTGTGATTACAAAGGCAAG
AATTTGGCTGTTCGAGTAGATGAATCAAGCCAGAAGCCATATTACCTAGCAATTAGCATC
TTCTACCAGGGTGGTCAAACTGAAATTGTCAGTGTTGATGTTGCTCAGGTTGGATCGTCG
AACTGGAACTTCTTGACCCGAAACCACGGAGCAATTTGGGACACAAGCAGAGTGCCAAGT
GGGGCATTGCAATTTAGGTTTGTGGTGACAGCAGGGTACGATGGCAAGTGGATTTGGGCT
AAATCAGTGCTGCCATCAGATTGGAAAATGGGGGTGATTTATGATACTGGAGTTCAAATC
ACTGACATTGCTCAAGAGGGTTGTTCCCCATGTGATGATGGAAGTTGGAAAACTTAATTA
GTTTTTTTTTTCTCTTCTTCTTAACTGTAACAATTCGTGTGAATACACACACACAGAGAA
TATTTAATAAAATTATAGATTGATTCAGTTTGAGTAGACATAGGGATACAAATTAAATTC
CTATTCTTTCTTGTTTAAGTCATATTAGTACTGTAACATCACATTCTTTTCGCTATCCAG
AACATTGATTAATGATATATCTC